FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629000_at:

>probe:Drosophila_2:1629000_at:520:37; Interrogation_Position=463; Antisense; ATCTCACGCATGCTGGGACATCAAT
>probe:Drosophila_2:1629000_at:522:271; Interrogation_Position=481; Antisense; CATCAATTGCGATCGATTCAGCTGC
>probe:Drosophila_2:1629000_at:413:119; Interrogation_Position=500; Antisense; AGCTGCAAAATCTTCCCTCGAAAGT
>probe:Drosophila_2:1629000_at:228:479; Interrogation_Position=523; Antisense; GTTTCGTTACAAAAGCCACGTCAGA
>probe:Drosophila_2:1629000_at:358:461; Interrogation_Position=578; Antisense; GATTTAGCGAAACCCACAGACTCCA
>probe:Drosophila_2:1629000_at:706:333; Interrogation_Position=668; Antisense; GCTGGGATGCTGAAGCTCAACGAAA
>probe:Drosophila_2:1629000_at:320:33; Interrogation_Position=702; Antisense; ATCAACAACGCCTGTGCCTCTATTG
>probe:Drosophila_2:1629000_at:394:9; Interrogation_Position=731; Antisense; ATTGCCTTCTCAAACGAATCGCACC
>probe:Drosophila_2:1629000_at:704:367; Interrogation_Position=746; Antisense; GAATCGCACCTGGAGAAGCACCTGA
>probe:Drosophila_2:1629000_at:164:131; Interrogation_Position=765; Antisense; ACCTGAGGGATCACCATGCTGAGCG
>probe:Drosophila_2:1629000_at:180:53; Interrogation_Position=780; Antisense; ATGCTGAGCGCCTTTATACAAGCGA
>probe:Drosophila_2:1629000_at:159:13; Interrogation_Position=805; Antisense; ATTAATAACCCCAGATTTCGAGACT
>probe:Drosophila_2:1629000_at:443:285; Interrogation_Position=828; Antisense; CTGATGGCTCAGAACGGATATGCGT
>probe:Drosophila_2:1629000_at:58:661; Interrogation_Position=858; Antisense; TAAACGAGGATGTAGCCTTTAGCTA

Paste this into a BLAST search page for me
ATCTCACGCATGCTGGGACATCAATCATCAATTGCGATCGATTCAGCTGCAGCTGCAAAATCTTCCCTCGAAAGTGTTTCGTTACAAAAGCCACGTCAGAGATTTAGCGAAACCCACAGACTCCAGCTGGGATGCTGAAGCTCAACGAAAATCAACAACGCCTGTGCCTCTATTGATTGCCTTCTCAAACGAATCGCACCGAATCGCACCTGGAGAAGCACCTGAACCTGAGGGATCACCATGCTGAGCGATGCTGAGCGCCTTTATACAAGCGAATTAATAACCCCAGATTTCGAGACTCTGATGGCTCAGAACGGATATGCGTTAAACGAGGATGTAGCCTTTAGCTA

Full Affymetrix probeset data:

Annotations for 1629000_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720