Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629001_at:

>probe:Drosophila_2:1629001_at:643:463; Interrogation_Position=2904; Antisense; GATTGCGCGCGAATGGAAGAGTCCA
>probe:Drosophila_2:1629001_at:226:215; Interrogation_Position=2920; Antisense; AAGAGTCCATGCTTCCACTGGCTGG
>probe:Drosophila_2:1629001_at:84:143; Interrogation_Position=2936; Antisense; ACTGGCTGGCCAAACAGGCTTTCGA
>probe:Drosophila_2:1629001_at:720:69; Interrogation_Position=2951; Antisense; AGGCTTTCGACGAGCTAGTGGCAAT
>probe:Drosophila_2:1629001_at:531:259; Interrogation_Position=3003; Antisense; CACTGTCTTTCCCTCTATAGAGTAA
>probe:Drosophila_2:1629001_at:429:125; Interrogation_Position=3066; Antisense; AGCCGAATATGCACTGGACCCATCA
>probe:Drosophila_2:1629001_at:186:241; Interrogation_Position=3099; Antisense; AATAGAGCGTGGGTTCTTCTTCAGC
>probe:Drosophila_2:1629001_at:237:485; Interrogation_Position=3139; Antisense; GTATGAGTCTGCATCTAGTTGTATT
>probe:Drosophila_2:1629001_at:673:103; Interrogation_Position=3166; Antisense; AGACCTTTATTATTGCACACATGAA
>probe:Drosophila_2:1629001_at:386:375; Interrogation_Position=3188; Antisense; GAAGAACCATCCTCTTGACTTTAAG
>probe:Drosophila_2:1629001_at:205:653; Interrogation_Position=3253; Antisense; TAACTTACCCAGATGGGCGTCTCTT
>probe:Drosophila_2:1629001_at:618:497; Interrogation_Position=3271; Antisense; GTCTCTTGCGCCCTGGGAAATAACT
>probe:Drosophila_2:1629001_at:553:649; Interrogation_Position=3306; Antisense; TCAGAAACGTTCTTCCTATTTGGAA
>probe:Drosophila_2:1629001_at:236:563; Interrogation_Position=3327; Antisense; GGAAGGTCCGATAGCAATTATGTCT

Paste this into a BLAST search page for me
GATTGCGCGCGAATGGAAGAGTCCAAAGAGTCCATGCTTCCACTGGCTGGACTGGCTGGCCAAACAGGCTTTCGAAGGCTTTCGACGAGCTAGTGGCAATCACTGTCTTTCCCTCTATAGAGTAAAGCCGAATATGCACTGGACCCATCAAATAGAGCGTGGGTTCTTCTTCAGCGTATGAGTCTGCATCTAGTTGTATTAGACCTTTATTATTGCACACATGAAGAAGAACCATCCTCTTGACTTTAAGTAACTTACCCAGATGGGCGTCTCTTGTCTCTTGCGCCCTGGGAAATAACTTCAGAAACGTTCTTCCTATTTGGAAGGAAGGTCCGATAGCAATTATGTCT

Full Affymetrix probeset data:

Annotations for 1629001_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime