Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629007_at:

>probe:Drosophila_2:1629007_at:294:443; Interrogation_Position=300; Antisense; GATGTTCGGCACTGTGGATCTGTTT
>probe:Drosophila_2:1629007_at:510:545; Interrogation_Position=315; Antisense; GGATCTGTTTAACGCGAATGCCCTG
>probe:Drosophila_2:1629007_at:425:367; Interrogation_Position=330; Antisense; GAATGCCCTGAACATGACGTCCAAC
>probe:Drosophila_2:1629007_at:191:241; Interrogation_Position=391; Antisense; AATAACGATGTCTCGCTGATCCAAC
>probe:Drosophila_2:1629007_at:353:151; Interrogation_Position=443; Antisense; ACATTCAGGCCATACAACTGGTCGG
>probe:Drosophila_2:1629007_at:66:557; Interrogation_Position=477; Antisense; GGACTCGATCGATTATGTGGGCAGC
>probe:Drosophila_2:1629007_at:308:391; Interrogation_Position=556; Antisense; GAAACCCTTTTGTATGCCCAAGTCG
>probe:Drosophila_2:1629007_at:272:251; Interrogation_Position=591; Antisense; CAATGCGGATTGTGTGGCCATCTAT
>probe:Drosophila_2:1629007_at:677:83; Interrogation_Position=630; Antisense; AGTGGACTCGACCATGTGTGCCAAA
>probe:Drosophila_2:1629007_at:203:441; Interrogation_Position=661; Antisense; GATGGTAGCGACATGTCCACTTGCA
>probe:Drosophila_2:1629007_at:227:249; Interrogation_Position=744; Antisense; AATTGGCATCAACTCATTCGTCGCT
>probe:Drosophila_2:1629007_at:412:717; Interrogation_Position=760; Antisense; TTCGTCGCTGAGGATCAATGCACAT
>probe:Drosophila_2:1629007_at:521:25; Interrogation_Position=783; Antisense; ATACCGGCTACCATCTGGATACGCA
>probe:Drosophila_2:1629007_at:652:719; Interrogation_Position=820; Antisense; TTCCTCGGCTTCATTGCAGACAAAA

Paste this into a BLAST search page for me
GATGTTCGGCACTGTGGATCTGTTTGGATCTGTTTAACGCGAATGCCCTGGAATGCCCTGAACATGACGTCCAACAATAACGATGTCTCGCTGATCCAACACATTCAGGCCATACAACTGGTCGGGGACTCGATCGATTATGTGGGCAGCGAAACCCTTTTGTATGCCCAAGTCGCAATGCGGATTGTGTGGCCATCTATAGTGGACTCGACCATGTGTGCCAAAGATGGTAGCGACATGTCCACTTGCAAATTGGCATCAACTCATTCGTCGCTTTCGTCGCTGAGGATCAATGCACATATACCGGCTACCATCTGGATACGCATTCCTCGGCTTCATTGCAGACAAAA

Full Affymetrix probeset data:

Annotations for 1629007_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime