FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629008_at:

>probe:Drosophila_2:1629008_at:28:615; Interrogation_Position=364; Antisense; TGAAGACGAGAAGCCGCAGGCCTCT
>probe:Drosophila_2:1629008_at:636:545; Interrogation_Position=394; Antisense; GGATGCCACGCTAACCAAACAGCAG
>probe:Drosophila_2:1629008_at:485:113; Interrogation_Position=414; Antisense; AGCAGCGTAAGAATGTGCCCCTCCA
>probe:Drosophila_2:1629008_at:655:627; Interrogation_Position=435; Antisense; TCCAGCTGCGTGTGAAGCCCAGTTT
>probe:Drosophila_2:1629008_at:627:613; Interrogation_Position=447; Antisense; TGAAGCCCAGTTTCCGGGACATGGA
>probe:Drosophila_2:1629008_at:58:337; Interrogation_Position=484; Antisense; GCTCCGCAAAGTTGCCACTCGTGGA
>probe:Drosophila_2:1629008_at:447:259; Interrogation_Position=499; Antisense; CACTCGTGGAGTGGTGCAGTTCTTT
>probe:Drosophila_2:1629008_at:163:51; Interrogation_Position=525; Antisense; ATGCCGTGCGCATTCAGCAGAAGGA
>probe:Drosophila_2:1629008_at:410:399; Interrogation_Position=584; Antisense; GACAGCCGACAGGATGCGGTGCTAA
>probe:Drosophila_2:1629008_at:592:121; Interrogation_Position=621; Antisense; AGCGAAAGTTTTTGGACGTCCTGAT
>probe:Drosophila_2:1629008_at:388:445; Interrogation_Position=643; Antisense; GATGAGCGGGAAGCGCGCCAAATCC
>probe:Drosophila_2:1629008_at:239:235; Interrogation_Position=663; Antisense; AATCCACACCCGTAGATAACGCTGT
>probe:Drosophila_2:1629008_at:727:375; Interrogation_Position=722; Antisense; GAAGACAAGGGCTCCAGCGGCAAAA
>probe:Drosophila_2:1629008_at:287:621; Interrogation_Position=765; Antisense; TGCTGCGCGAGGACTTCATGACCAA

Paste this into a BLAST search page for me
TGAAGACGAGAAGCCGCAGGCCTCTGGATGCCACGCTAACCAAACAGCAGAGCAGCGTAAGAATGTGCCCCTCCATCCAGCTGCGTGTGAAGCCCAGTTTTGAAGCCCAGTTTCCGGGACATGGAGCTCCGCAAAGTTGCCACTCGTGGACACTCGTGGAGTGGTGCAGTTCTTTATGCCGTGCGCATTCAGCAGAAGGAGACAGCCGACAGGATGCGGTGCTAAAGCGAAAGTTTTTGGACGTCCTGATGATGAGCGGGAAGCGCGCCAAATCCAATCCACACCCGTAGATAACGCTGTGAAGACAAGGGCTCCAGCGGCAAAATGCTGCGCGAGGACTTCATGACCAA

Full Affymetrix probeset data:

Annotations for 1629008_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720