Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629009_at:

>probe:Drosophila_2:1629009_at:170:371; Interrogation_Position=1231; Antisense; GAAGGTCCCAACTTCGTCGTGGAGA
>probe:Drosophila_2:1629009_at:118:355; Interrogation_Position=1259; Antisense; GCACCACTGTGGTTGTACCTCACTA
>probe:Drosophila_2:1629009_at:105:281; Interrogation_Position=1277; Antisense; CTCACTACTGCTTCATGCTGGATGA
>probe:Drosophila_2:1629009_at:684:443; Interrogation_Position=1297; Antisense; GATGAGGAATTCTTTCCCAATCCCC
>probe:Drosophila_2:1629009_at:173:275; Interrogation_Position=1419; Antisense; CATTGGAATGCGATTTGCGACGGTC
>probe:Drosophila_2:1629009_at:721:323; Interrogation_Position=1435; Antisense; GCGACGGTCCAGATTAAGGCTGCTA
>probe:Drosophila_2:1629009_at:655:395; Interrogation_Position=1513; Antisense; GACAATGATTATGAACCCGGCCAAA
>probe:Drosophila_2:1629009_at:327:577; Interrogation_Position=1531; Antisense; GGCCAAATTATCACTGGTCTGCGTG
>probe:Drosophila_2:1629009_at:106:523; Interrogation_Position=1557; Antisense; GGGCATTTGGCTCGACCTTGAAAAG
>probe:Drosophila_2:1629009_at:339:547; Interrogation_Position=1592; Antisense; TCAATTACTTAATAACTCCCCACCA
>probe:Drosophila_2:1629009_at:253:163; Interrogation_Position=1636; Antisense; AAATTGAGTGGCGTAGTTCCCCAGT
>probe:Drosophila_2:1629009_at:701:485; Interrogation_Position=1648; Antisense; GTAGTTCCCCAGTCTATTTTTACAG
>probe:Drosophila_2:1629009_at:489:267; Interrogation_Position=1692; Antisense; CAGTGGTACACTTAAGCTCGCAATT
>probe:Drosophila_2:1629009_at:484:337; Interrogation_Position=1707; Antisense; GCTCGCAATTGGCTGACTTTGTTAT

Paste this into a BLAST search page for me
GAAGGTCCCAACTTCGTCGTGGAGAGCACCACTGTGGTTGTACCTCACTACTCACTACTGCTTCATGCTGGATGAGATGAGGAATTCTTTCCCAATCCCCCATTGGAATGCGATTTGCGACGGTCGCGACGGTCCAGATTAAGGCTGCTAGACAATGATTATGAACCCGGCCAAAGGCCAAATTATCACTGGTCTGCGTGGGGCATTTGGCTCGACCTTGAAAAGTCAATTACTTAATAACTCCCCACCAAAATTGAGTGGCGTAGTTCCCCAGTGTAGTTCCCCAGTCTATTTTTACAGCAGTGGTACACTTAAGCTCGCAATTGCTCGCAATTGGCTGACTTTGTTAT

Full Affymetrix probeset data:

Annotations for 1629009_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime