FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629010_at:

>probe:Drosophila_2:1629010_at:539:643; Interrogation_Position=4996; Antisense; TCTCATTTGGACATGCGTTCTGTTC
>probe:Drosophila_2:1629010_at:22:59; Interrogation_Position=5042; Antisense; ATGATTGTCACCTTTTACATCCACC
>probe:Drosophila_2:1629010_at:490:321; Interrogation_Position=5070; Antisense; GCGAATTCCATTCCATTAGCTTTGT
>probe:Drosophila_2:1629010_at:527:705; Interrogation_Position=5119; Antisense; TTACGACAACTTCACCAATGCCGAT
>probe:Drosophila_2:1629010_at:614:233; Interrogation_Position=5135; Antisense; AATGCCGATCACCATGGCGTCGATG
>probe:Drosophila_2:1629010_at:306:351; Interrogation_Position=5185; Antisense; GCAGACGCAGAACTCGCAGTACTAC
>probe:Drosophila_2:1629010_at:475:89; Interrogation_Position=5202; Antisense; AGTACTACTACCATCATCACTCGGA
>probe:Drosophila_2:1629010_at:135:213; Interrogation_Position=5240; Antisense; AAGAGCGTGACCTTCACCGAGAAAG
>probe:Drosophila_2:1629010_at:676:423; Interrogation_Position=5258; Antisense; GAGAAAGCGCTCGTTTCGCACATTT
>probe:Drosophila_2:1629010_at:676:479; Interrogation_Position=5270; Antisense; GTTTCGCACATTTTGTATCCCACTG
>probe:Drosophila_2:1629010_at:316:23; Interrogation_Position=5337; Antisense; ATAGTCGTTCGTTTAATCATCTTTC
>probe:Drosophila_2:1629010_at:155:709; Interrogation_Position=5420; Antisense; TTCACTTCACCCATTAGATTCTCGA
>probe:Drosophila_2:1629010_at:255:387; Interrogation_Position=5449; Antisense; GAACAACCACTCTAATCTTATGACT
>probe:Drosophila_2:1629010_at:554:405; Interrogation_Position=5470; Antisense; GACTGAATTAACATCGGTGCACTCC

Paste this into a BLAST search page for me
TCTCATTTGGACATGCGTTCTGTTCATGATTGTCACCTTTTACATCCACCGCGAATTCCATTCCATTAGCTTTGTTTACGACAACTTCACCAATGCCGATAATGCCGATCACCATGGCGTCGATGGCAGACGCAGAACTCGCAGTACTACAGTACTACTACCATCATCACTCGGAAAGAGCGTGACCTTCACCGAGAAAGGAGAAAGCGCTCGTTTCGCACATTTGTTTCGCACATTTTGTATCCCACTGATAGTCGTTCGTTTAATCATCTTTCTTCACTTCACCCATTAGATTCTCGAGAACAACCACTCTAATCTTATGACTGACTGAATTAACATCGGTGCACTCC

Full Affymetrix probeset data:

Annotations for 1629010_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720