FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629012_at:

>probe:Drosophila_2:1629012_at:116:535; Interrogation_Position=1484; Antisense; GGTGCCGACGGTATCGATCGACAAG
>probe:Drosophila_2:1629012_at:104:213; Interrogation_Position=1506; Antisense; AAGACCGACGGCTGCCAGATGTATC
>probe:Drosophila_2:1629012_at:138:551; Interrogation_Position=1577; Antisense; GGAGATGAACATCCTGTTGCCCGAC
>probe:Drosophila_2:1629012_at:255:1; Interrogation_Position=1615; Antisense; ATACCGAGTTGGCTTTACCGGAGCA
>probe:Drosophila_2:1629012_at:443:31; Interrogation_Position=1642; Antisense; ATAAGACCACGATTGCCGGCAAGAC
>probe:Drosophila_2:1629012_at:666:317; Interrogation_Position=1656; Antisense; GCCGGCAAGACCCTGAAGACTGTGT
>probe:Drosophila_2:1629012_at:514:211; Interrogation_Position=1671; Antisense; AAGACTGTGTGCGTGGACAGCCTCG
>probe:Drosophila_2:1629012_at:125:529; Interrogation_Position=1718; Antisense; GGGATCCTGTTCGTTGCTTTTCCAA
>probe:Drosophila_2:1629012_at:434:693; Interrogation_Position=1736; Antisense; TTTCCAACTGTCGTCAGCAGCAATC
>probe:Drosophila_2:1629012_at:432:59; Interrogation_Position=1833; Antisense; ATGTTGCCAAACATTGCTGTCCTGG
>probe:Drosophila_2:1629012_at:3:623; Interrogation_Position=1847; Antisense; TGCTGTCCTGGCTCGTGGAAAGTAT
>probe:Drosophila_2:1629012_at:37:311; Interrogation_Position=1903; Antisense; GCCACAAACCGAACCCAATGTATTT
>probe:Drosophila_2:1629012_at:165:167; Interrogation_Position=1964; Antisense; AAATCCGAACTTTTGAGCAGACTCT
>probe:Drosophila_2:1629012_at:709:113; Interrogation_Position=1979; Antisense; AGCAGACTCTTTACTCGATCATCAG

Paste this into a BLAST search page for me
GGTGCCGACGGTATCGATCGACAAGAAGACCGACGGCTGCCAGATGTATCGGAGATGAACATCCTGTTGCCCGACATACCGAGTTGGCTTTACCGGAGCAATAAGACCACGATTGCCGGCAAGACGCCGGCAAGACCCTGAAGACTGTGTAAGACTGTGTGCGTGGACAGCCTCGGGGATCCTGTTCGTTGCTTTTCCAATTTCCAACTGTCGTCAGCAGCAATCATGTTGCCAAACATTGCTGTCCTGGTGCTGTCCTGGCTCGTGGAAAGTATGCCACAAACCGAACCCAATGTATTTAAATCCGAACTTTTGAGCAGACTCTAGCAGACTCTTTACTCGATCATCAG

Full Affymetrix probeset data:

Annotations for 1629012_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720