Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629016_s_at:

>probe:Drosophila_2:1629016_s_at:314:293; Interrogation_Position=114; Antisense; GCGTCGCCAGTCACGGGCCCTGGAA
>probe:Drosophila_2:1629016_s_at:566:83; Interrogation_Position=122; Antisense; AGTCACGGGCCCTGGAATGCCTGGC
>probe:Drosophila_2:1629016_s_at:314:135; Interrogation_Position=126; Antisense; ACGGGCCCTGGAATGCCTGGCTCCA
>probe:Drosophila_2:1629016_s_at:552:127; Interrogation_Position=157; Antisense; ACCGGATCCTTCAGGCAGCGCAATT
>probe:Drosophila_2:1629016_s_at:215:545; Interrogation_Position=160; Antisense; GGATCCTTCAGGCAGCGCAATTCGC
>probe:Drosophila_2:1629016_s_at:328:581; Interrogation_Position=221; Antisense; TGGCCTTCTGCAAACGCCGCCTGAG
>probe:Drosophila_2:1629016_s_at:175:177; Interrogation_Position=232; Antisense; AAACGCCGCCTGAGCTGGCCCGAAG
>probe:Drosophila_2:1629016_s_at:301:285; Interrogation_Position=241; Antisense; CTGAGCTGGCCCGAAGTGGATCCGC
>probe:Drosophila_2:1629016_s_at:131:121; Interrogation_Position=244; Antisense; AGCTGGCCCGAAGTGGATCCGCGCT
>probe:Drosophila_2:1629016_s_at:619:301; Interrogation_Position=250; Antisense; CCCGAAGTGGATCCGCGCTCCAATT
>probe:Drosophila_2:1629016_s_at:88:623; Interrogation_Position=31; Antisense; TACCCCAAAATACCAGGTGGTGCCG
>probe:Drosophila_2:1629016_s_at:254:253; Interrogation_Position=36; Antisense; CAAAATACCAGGTGGTGCCGCGGGA
>probe:Drosophila_2:1629016_s_at:118:151; Interrogation_Position=76; Antisense; ACATCCGGCTCCGTTGGGCCAGGTG
>probe:Drosophila_2:1629016_s_at:518:467; Interrogation_Position=88; Antisense; GTTGGGCCAGGTGGCACGCCCCAGT

Paste this into a BLAST search page for me
GCGTCGCCAGTCACGGGCCCTGGAAAGTCACGGGCCCTGGAATGCCTGGCACGGGCCCTGGAATGCCTGGCTCCAACCGGATCCTTCAGGCAGCGCAATTGGATCCTTCAGGCAGCGCAATTCGCTGGCCTTCTGCAAACGCCGCCTGAGAAACGCCGCCTGAGCTGGCCCGAAGCTGAGCTGGCCCGAAGTGGATCCGCAGCTGGCCCGAAGTGGATCCGCGCTCCCGAAGTGGATCCGCGCTCCAATTTACCCCAAAATACCAGGTGGTGCCGCAAAATACCAGGTGGTGCCGCGGGAACATCCGGCTCCGTTGGGCCAGGTGGTTGGGCCAGGTGGCACGCCCCAGT

Full Affymetrix probeset data:

Annotations for 1629016_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime