Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629017_s_at:

>probe:Drosophila_2:1629017_s_at:476:81; Interrogation_Position=104; Antisense; AGGTGGGAGCCTCTGCCAACACACT
>probe:Drosophila_2:1629017_s_at:307:643; Interrogation_Position=115; Antisense; TCTGCCAACACACTGCCACAAGTAT
>probe:Drosophila_2:1629017_s_at:595:185; Interrogation_Position=121; Antisense; AACACACTGCCACAAGTATTCGTTA
>probe:Drosophila_2:1629017_s_at:38:623; Interrogation_Position=128; Antisense; TGCCACAAGTATTCGTTAAACCCAG
>probe:Drosophila_2:1629017_s_at:591:249; Interrogation_Position=133; Antisense; CAAGTATTCGTTAAACCCAGCCTGC
>probe:Drosophila_2:1629017_s_at:293:91; Interrogation_Position=135; Antisense; AGTATTCGTTAAACCCAGCCTGCCG
>probe:Drosophila_2:1629017_s_at:473:11; Interrogation_Position=138; Antisense; ATTCGTTAAACCCAGCCTGCCGCAG
>probe:Drosophila_2:1629017_s_at:63:353; Interrogation_Position=159; Antisense; GCAGCCCAGCGCTGGCGGCGATGTG
>probe:Drosophila_2:1629017_s_at:696:595; Interrogation_Position=180; Antisense; TGTGGTGACCACGACTGGAGCTGCT
>probe:Drosophila_2:1629017_s_at:668:533; Interrogation_Position=183; Antisense; GGTGACCACGACTGGAGCTGCTCGC
>probe:Drosophila_2:1629017_s_at:154:359; Interrogation_Position=216; Antisense; GCAACAACTGCCCACAAAGTTCATT
>probe:Drosophila_2:1629017_s_at:512:157; Interrogation_Position=219; Antisense; ACAACTGCCCACAAAGTTCATTTAG
>probe:Drosophila_2:1629017_s_at:147:43; Interrogation_Position=25; Antisense; ATCGTGCTCTCCACGATGAGCCACG
>probe:Drosophila_2:1629017_s_at:661:315; Interrogation_Position=57; Antisense; GCGCTACGACCTGCTGGCCAACGGC

Paste this into a BLAST search page for me
AGGTGGGAGCCTCTGCCAACACACTTCTGCCAACACACTGCCACAAGTATAACACACTGCCACAAGTATTCGTTATGCCACAAGTATTCGTTAAACCCAGCAAGTATTCGTTAAACCCAGCCTGCAGTATTCGTTAAACCCAGCCTGCCGATTCGTTAAACCCAGCCTGCCGCAGGCAGCCCAGCGCTGGCGGCGATGTGTGTGGTGACCACGACTGGAGCTGCTGGTGACCACGACTGGAGCTGCTCGCGCAACAACTGCCCACAAAGTTCATTACAACTGCCCACAAAGTTCATTTAGATCGTGCTCTCCACGATGAGCCACGGCGCTACGACCTGCTGGCCAACGGC

Full Affymetrix probeset data:

Annotations for 1629017_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime