Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629018_a_at:

>probe:Drosophila_2:1629018_a_at:56:229; Interrogation_Position=192; Antisense; AATGGCGTTCCGGATAGACTGCCTC
>probe:Drosophila_2:1629018_a_at:214:671; Interrogation_Position=206; Antisense; TAGACTGCCTCCGATCAACGTAAAG
>probe:Drosophila_2:1629018_a_at:185:583; Interrogation_Position=282; Antisense; TGGCTGATGCCCATGATCGGACATA
>probe:Drosophila_2:1629018_a_at:507:23; Interrogation_Position=304; Antisense; ATATGGGCATTTGCACTTCGTCCGG
>probe:Drosophila_2:1629018_a_at:568:575; Interrogation_Position=348; Antisense; GGCCCCTACTTCGTATCAGAGGACA
>probe:Drosophila_2:1629018_a_at:660:679; Interrogation_Position=382; Antisense; TTGGAAGACCCACCCGGTACATAAG
>probe:Drosophila_2:1629018_a_at:56:539; Interrogation_Position=397; Antisense; GGTACATAAGGTTGCACCCCAAGCA
>probe:Drosophila_2:1629018_a_at:288:439; Interrogation_Position=450; Antisense; GAGGCGGTCTCCAAAGCATCTGTGC
>probe:Drosophila_2:1629018_a_at:336:23; Interrogation_Position=496; Antisense; ATATCTTCTGTGACAACTGCCACTC
>probe:Drosophila_2:1629018_a_at:660:61; Interrogation_Position=523; Antisense; ATGTGGCAACGGCACTCATCTACAT
>probe:Drosophila_2:1629018_a_at:37:137; Interrogation_Position=556; Antisense; ACGACAGCACCGCATGGAACATGAT
>probe:Drosophila_2:1629018_a_at:361:461; Interrogation_Position=578; Antisense; GATTATCCTCAGCATGTGGCTCTTT
>probe:Drosophila_2:1629018_a_at:487:477; Interrogation_Position=631; Antisense; GTTTTATTAAGACCTGGCTGCCGTT
>probe:Drosophila_2:1629018_a_at:490:37; Interrogation_Position=672; Antisense; ATCTTCACCATTCTGGGCATCTATT

Paste this into a BLAST search page for me
AATGGCGTTCCGGATAGACTGCCTCTAGACTGCCTCCGATCAACGTAAAGTGGCTGATGCCCATGATCGGACATAATATGGGCATTTGCACTTCGTCCGGGGCCCCTACTTCGTATCAGAGGACATTGGAAGACCCACCCGGTACATAAGGGTACATAAGGTTGCACCCCAAGCAGAGGCGGTCTCCAAAGCATCTGTGCATATCTTCTGTGACAACTGCCACTCATGTGGCAACGGCACTCATCTACATACGACAGCACCGCATGGAACATGATGATTATCCTCAGCATGTGGCTCTTTGTTTTATTAAGACCTGGCTGCCGTTATCTTCACCATTCTGGGCATCTATT

Full Affymetrix probeset data:

Annotations for 1629018_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime