Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629019_s_at:

>probe:Drosophila_2:1629019_s_at:664:415; Interrogation_Position=237; Antisense; GAGCCTTCGGCAAGCTTGAGGCTGC
>probe:Drosophila_2:1629019_s_at:729:551; Interrogation_Position=295; Antisense; GGAGCAGCTGGATCGCCTTAAGAAC
>probe:Drosophila_2:1629019_s_at:523:707; Interrogation_Position=312; Antisense; TTAAGAACGACCAGATCCACCAGGC
>probe:Drosophila_2:1629019_s_at:520:97; Interrogation_Position=324; Antisense; AGATCCACCAGGCTGAGTTCCACCA
>probe:Drosophila_2:1629019_s_at:608:77; Interrogation_Position=369; Antisense; AGGAGGCCATCCAGCGCCACAAGGA
>probe:Drosophila_2:1629019_s_at:262:471; Interrogation_Position=394; Antisense; GTTCCTCGAGAACCTGCACAAGTGA
>probe:Drosophila_2:1629019_s_at:351:255; Interrogation_Position=410; Antisense; CACAAGTGAGCGGTGATCCATCCAC
>probe:Drosophila_2:1629019_s_at:512:511; Interrogation_Position=422; Antisense; GTGATCCATCCACCGGCAGAAGGCG
>probe:Drosophila_2:1629019_s_at:254:355; Interrogation_Position=450; Antisense; GCACGGACGGATGAACTCGAGACAT
>probe:Drosophila_2:1629019_s_at:67:167; Interrogation_Position=481; Antisense; AAATGCATTTCACTCTCTTTTGTAT
>probe:Drosophila_2:1629019_s_at:709:645; Interrogation_Position=490; Antisense; TCACTCTCTTTTGTATGTTCCCAAG
>probe:Drosophila_2:1629019_s_at:717:727; Interrogation_Position=500; Antisense; TTGTATGTTCCCAAGTGCTCACTAC
>probe:Drosophila_2:1629019_s_at:312:85; Interrogation_Position=513; Antisense; AGTGCTCACTACCACTTACCAGTAA
>probe:Drosophila_2:1629019_s_at:393:387; Interrogation_Position=560; Antisense; GAAAAGTGCGTAATAAACCATCCAT

Paste this into a BLAST search page for me
GAGCCTTCGGCAAGCTTGAGGCTGCGGAGCAGCTGGATCGCCTTAAGAACTTAAGAACGACCAGATCCACCAGGCAGATCCACCAGGCTGAGTTCCACCAAGGAGGCCATCCAGCGCCACAAGGAGTTCCTCGAGAACCTGCACAAGTGACACAAGTGAGCGGTGATCCATCCACGTGATCCATCCACCGGCAGAAGGCGGCACGGACGGATGAACTCGAGACATAAATGCATTTCACTCTCTTTTGTATTCACTCTCTTTTGTATGTTCCCAAGTTGTATGTTCCCAAGTGCTCACTACAGTGCTCACTACCACTTACCAGTAAGAAAAGTGCGTAATAAACCATCCAT

Full Affymetrix probeset data:

Annotations for 1629019_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime