Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629021_at:

>probe:Drosophila_2:1629021_at:603:101; Interrogation_Position=3315; Antisense; AGAGCACCCCTCGATTGTGACATTC
>probe:Drosophila_2:1629021_at:576:479; Interrogation_Position=3356; Antisense; GTTTCGATGATATGCAGCGCCGGCA
>probe:Drosophila_2:1629021_at:320:289; Interrogation_Position=3376; Antisense; CGGCAGCTGCTAAAATTTGTCACCA
>probe:Drosophila_2:1629021_at:572:435; Interrogation_Position=3408; Antisense; GAGGCCACCGTTGTTGGGCTTTAAG
>probe:Drosophila_2:1629021_at:343:427; Interrogation_Position=3467; Antisense; GAGATATGGAACGTCTGCCCACGGC
>probe:Drosophila_2:1629021_at:515:355; Interrogation_Position=3500; Antisense; GCACGAATCTGCTAAAACTTCCGCC
>probe:Drosophila_2:1629021_at:132:387; Interrogation_Position=3538; Antisense; GAACAAATGCGCGAAAAGCTGCTCT
>probe:Drosophila_2:1629021_at:377:207; Interrogation_Position=3553; Antisense; AAGCTGCTCTATGCCATACAGTCTG
>probe:Drosophila_2:1629021_at:273:267; Interrogation_Position=3571; Antisense; CAGTCTGGCGCTGGCTTTGAACTAA
>probe:Drosophila_2:1629021_at:701:657; Interrogation_Position=3598; Antisense; TAAGCACTAAGCTGTCACTTCCCAA
>probe:Drosophila_2:1629021_at:254:445; Interrogation_Position=3656; Antisense; GATGACTACCAAACCCCATACAATT
>probe:Drosophila_2:1629021_at:288:677; Interrogation_Position=3701; Antisense; TAGATCGCAGGACGGCAAGTTGACA
>probe:Drosophila_2:1629021_at:502:489; Interrogation_Position=3761; Antisense; GTACATTTGATTACCGCAATTGCTT
>probe:Drosophila_2:1629021_at:244:81; Interrogation_Position=3806; Antisense; AGAGGTCTGTTTATCCACGTTTTCT

Paste this into a BLAST search page for me
AGAGCACCCCTCGATTGTGACATTCGTTTCGATGATATGCAGCGCCGGCACGGCAGCTGCTAAAATTTGTCACCAGAGGCCACCGTTGTTGGGCTTTAAGGAGATATGGAACGTCTGCCCACGGCGCACGAATCTGCTAAAACTTCCGCCGAACAAATGCGCGAAAAGCTGCTCTAAGCTGCTCTATGCCATACAGTCTGCAGTCTGGCGCTGGCTTTGAACTAATAAGCACTAAGCTGTCACTTCCCAAGATGACTACCAAACCCCATACAATTTAGATCGCAGGACGGCAAGTTGACAGTACATTTGATTACCGCAATTGCTTAGAGGTCTGTTTATCCACGTTTTCT

Full Affymetrix probeset data:

Annotations for 1629021_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime