Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629022_at:

>probe:Drosophila_2:1629022_at:333:109; Interrogation_Position=4989; Antisense; AGAAGCCCAAGCGTGAGGGTCGCCT
>probe:Drosophila_2:1629022_at:488:283; Interrogation_Position=5012; Antisense; CTGCCAAGGCTCTACCTCAAGAAGA
>probe:Drosophila_2:1629022_at:696:155; Interrogation_Position=5079; Antisense; ACACTAAGAACTTTGTGCGCGCCTT
>probe:Drosophila_2:1629022_at:459:623; Interrogation_Position=5094; Antisense; TGCGCGCCTTCCGTGAGGATGGCTA
>probe:Drosophila_2:1629022_at:271:77; Interrogation_Position=5109; Antisense; AGGATGGCTACACCGGTGACCAGAT
>probe:Drosophila_2:1629022_at:511:337; Interrogation_Position=5146; Antisense; GCTCCTGACCGTGGACAACATGCAG
>probe:Drosophila_2:1629022_at:699:309; Interrogation_Position=5226; Antisense; CCAACTACAACTTCAGGACCAACGT
>probe:Drosophila_2:1629022_at:582:413; Interrogation_Position=5242; Antisense; GACCAACGTTGATATGCGCGACGGT
>probe:Drosophila_2:1629022_at:280:407; Interrogation_Position=5261; Antisense; GACGGTCCCGAGTTTAGTCGACTCA
>probe:Drosophila_2:1629022_at:627:697; Interrogation_Position=5273; Antisense; TTTAGTCGACTCAAGGTGCGCGAGG
>probe:Drosophila_2:1629022_at:305:425; Interrogation_Position=5324; Antisense; GAGACCTGGGAAACGATGCACAAGA
>probe:Drosophila_2:1629022_at:681:437; Interrogation_Position=5371; Antisense; GAGGAACCCCAAGATGTACGAGAAC
>probe:Drosophila_2:1629022_at:636:293; Interrogation_Position=5389; Antisense; CGAGAACGTGATATAGCTTACCATA
>probe:Drosophila_2:1629022_at:603:699; Interrogation_Position=5472; Antisense; TTTTCTTATCAGCAGGAGGACCTAT

Paste this into a BLAST search page for me
AGAAGCCCAAGCGTGAGGGTCGCCTCTGCCAAGGCTCTACCTCAAGAAGAACACTAAGAACTTTGTGCGCGCCTTTGCGCGCCTTCCGTGAGGATGGCTAAGGATGGCTACACCGGTGACCAGATGCTCCTGACCGTGGACAACATGCAGCCAACTACAACTTCAGGACCAACGTGACCAACGTTGATATGCGCGACGGTGACGGTCCCGAGTTTAGTCGACTCATTTAGTCGACTCAAGGTGCGCGAGGGAGACCTGGGAAACGATGCACAAGAGAGGAACCCCAAGATGTACGAGAACCGAGAACGTGATATAGCTTACCATATTTTCTTATCAGCAGGAGGACCTAT

Full Affymetrix probeset data:

Annotations for 1629022_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime