FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629024_at:

>probe:Drosophila_2:1629024_at:630:15; Interrogation_Position=1240; Antisense; ATTATGCTACATACCACATCGGCGG
>probe:Drosophila_2:1629024_at:410:345; Interrogation_Position=1291; Antisense; GCATATCGCAAGTGTCGCTTCAGTG
>probe:Drosophila_2:1629024_at:507:39; Interrogation_Position=1325; Antisense; ATCTGCAGTATTACAGTCCCTACCA
>probe:Drosophila_2:1629024_at:190:277; Interrogation_Position=1357; Antisense; CTTTGCCGACTTGAGTGCCGAATCA
>probe:Drosophila_2:1629024_at:476:589; Interrogation_Position=1397; Antisense; TGTGCAACTGCAAGCCCTATTTCTA
>probe:Drosophila_2:1629024_at:613:687; Interrogation_Position=1414; Antisense; TATTTCTACGTAGCAGCTCCCGAAG
>probe:Drosophila_2:1629024_at:42:303; Interrogation_Position=1433; Antisense; CCGAAGTTCCAATCTGCACAGTATC
>probe:Drosophila_2:1629024_at:109:393; Interrogation_Position=1492; Antisense; GAAAGACCATGCGATTGCTATCCGT
>probe:Drosophila_2:1629024_at:719:619; Interrogation_Position=1507; Antisense; TGCTATCCGTCTTGTCGCGAGGAAA
>probe:Drosophila_2:1629024_at:259:311; Interrogation_Position=1523; Antisense; GCGAGGAAACCTTTACCATCTTCAA
>probe:Drosophila_2:1629024_at:546:575; Interrogation_Position=1567; Antisense; GGCGATGACAACTACTCTGGCGAGA
>probe:Drosophila_2:1629024_at:27:557; Interrogation_Position=1601; Antisense; GGACGCTGATCATCAACCTGCAAAT
>probe:Drosophila_2:1629024_at:651:165; Interrogation_Position=1641; Antisense; AAATCGGCGGGTTGTATTCAGCACG
>probe:Drosophila_2:1629024_at:122:555; Interrogation_Position=1711; Antisense; GGAGCCAGCTTCATGACCATATACG

Paste this into a BLAST search page for me
ATTATGCTACATACCACATCGGCGGGCATATCGCAAGTGTCGCTTCAGTGATCTGCAGTATTACAGTCCCTACCACTTTGCCGACTTGAGTGCCGAATCATGTGCAACTGCAAGCCCTATTTCTATATTTCTACGTAGCAGCTCCCGAAGCCGAAGTTCCAATCTGCACAGTATCGAAAGACCATGCGATTGCTATCCGTTGCTATCCGTCTTGTCGCGAGGAAAGCGAGGAAACCTTTACCATCTTCAAGGCGATGACAACTACTCTGGCGAGAGGACGCTGATCATCAACCTGCAAATAAATCGGCGGGTTGTATTCAGCACGGGAGCCAGCTTCATGACCATATACG

Full Affymetrix probeset data:

Annotations for 1629024_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720