FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629025_at:

>probe:Drosophila_2:1629025_at:662:365; Interrogation_Position=101; Antisense; GAATCCTGGAGGACGGACTCACAGT
>probe:Drosophila_2:1629025_at:394:73; Interrogation_Position=110; Antisense; AGGACGGACTCACAGTATCCACGTG
>probe:Drosophila_2:1629025_at:515:625; Interrogation_Position=133; Antisense; TGCCATCGCCCGCTTTTGTTGTTGC
>probe:Drosophila_2:1629025_at:634:721; Interrogation_Position=148; Antisense; TTGTTGTTGCCACAGTGGGTCATGT
>probe:Drosophila_2:1629025_at:408:633; Interrogation_Position=213; Antisense; TCCCATGGTCCGATGGTGCTATGGT
>probe:Drosophila_2:1629025_at:335:507; Interrogation_Position=228; Antisense; GTGCTATGGTGTGGTCTCCGTTGTC
>probe:Drosophila_2:1629025_at:361:503; Interrogation_Position=250; Antisense; GTCCTGGCACCAGTTAAGTGGCTTT
>probe:Drosophila_2:1629025_at:156:399; Interrogation_Position=283; Antisense; GACAGACGACGACCAAGTTGAAAGT
>probe:Drosophila_2:1629025_at:236:433; Interrogation_Position=327; Antisense; GAGGGCTCCCAAGATGAATCCTTTT
>probe:Drosophila_2:1629025_at:653:443; Interrogation_Position=339; Antisense; GATGAATCCTTTTTGGTCCACAAGC
>probe:Drosophila_2:1629025_at:417:623; Interrogation_Position=367; Antisense; TGCCCCAAGGTAGTCCCTGAATGTT
>probe:Drosophila_2:1629025_at:128:273; Interrogation_Position=396; Antisense; CATTGTGTTCACCTTCAAAGCGAAG
>probe:Drosophila_2:1629025_at:193:447; Interrogation_Position=435; Antisense; GATGCGGCTCATTTGTGTGCTACCA
>probe:Drosophila_2:1629025_at:512:1; Interrogation_Position=72; Antisense; ACTTCTAAGTCCTCTAAGCCAACTA

Paste this into a BLAST search page for me
GAATCCTGGAGGACGGACTCACAGTAGGACGGACTCACAGTATCCACGTGTGCCATCGCCCGCTTTTGTTGTTGCTTGTTGTTGCCACAGTGGGTCATGTTCCCATGGTCCGATGGTGCTATGGTGTGCTATGGTGTGGTCTCCGTTGTCGTCCTGGCACCAGTTAAGTGGCTTTGACAGACGACGACCAAGTTGAAAGTGAGGGCTCCCAAGATGAATCCTTTTGATGAATCCTTTTTGGTCCACAAGCTGCCCCAAGGTAGTCCCTGAATGTTCATTGTGTTCACCTTCAAAGCGAAGGATGCGGCTCATTTGTGTGCTACCAACTTCTAAGTCCTCTAAGCCAACTA

Full Affymetrix probeset data:

Annotations for 1629025_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720