Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629026_at:

>probe:Drosophila_2:1629026_at:354:447; Interrogation_Position=1393; Antisense; GATGCCTGATCCAAACAATCCGGTC
>probe:Drosophila_2:1629026_at:192:497; Interrogation_Position=1415; Antisense; GTCTACTCCAACTCTTACGATATGT
>probe:Drosophila_2:1629026_at:93:139; Interrogation_Position=1431; Antisense; ACGATATGTTCATGCGCGGCGAGGA
>probe:Drosophila_2:1629026_at:548:209; Interrogation_Position=1511; Antisense; AAGCACCATGGCATTGATACCTCCA
>probe:Drosophila_2:1629026_at:162:457; Interrogation_Position=1526; Antisense; GATACCTCCAAGATTGCGGCGTACA
>probe:Drosophila_2:1629026_at:423:667; Interrogation_Position=1547; Antisense; TACATCGAGTCCTTCCGCTATGGAT
>probe:Drosophila_2:1629026_at:341:681; Interrogation_Position=1565; Antisense; TATGGATGTCCTCCACATGCTGGTG
>probe:Drosophila_2:1629026_at:702:557; Interrogation_Position=1633; Antisense; GGACAACATCCGCAAGACTTCCATG
>probe:Drosophila_2:1629026_at:620:199; Interrogation_Position=1681; Antisense; AACGCCTTAAGCACGATAGACTCAA
>probe:Drosophila_2:1629026_at:116:249; Interrogation_Position=1744; Antisense; CAATTGTTTTACTTTCCCTGTGACT
>probe:Drosophila_2:1629026_at:639:511; Interrogation_Position=1763; Antisense; GTGACTTTCCAAGCATTCAGTTCTT
>probe:Drosophila_2:1629026_at:445:701; Interrogation_Position=1793; Antisense; TTTTACGCCAAACCCAATCGTGAGT
>probe:Drosophila_2:1629026_at:130:515; Interrogation_Position=1816; Antisense; GTGTTTTATCCTTCTTCTCAAGACT
>probe:Drosophila_2:1629026_at:567:147; Interrogation_Position=1930; Antisense; ACTTGCGCGTATGTTTTGTACTTTA

Paste this into a BLAST search page for me
GATGCCTGATCCAAACAATCCGGTCGTCTACTCCAACTCTTACGATATGTACGATATGTTCATGCGCGGCGAGGAAAGCACCATGGCATTGATACCTCCAGATACCTCCAAGATTGCGGCGTACATACATCGAGTCCTTCCGCTATGGATTATGGATGTCCTCCACATGCTGGTGGGACAACATCCGCAAGACTTCCATGAACGCCTTAAGCACGATAGACTCAACAATTGTTTTACTTTCCCTGTGACTGTGACTTTCCAAGCATTCAGTTCTTTTTTACGCCAAACCCAATCGTGAGTGTGTTTTATCCTTCTTCTCAAGACTACTTGCGCGTATGTTTTGTACTTTA

Full Affymetrix probeset data:

Annotations for 1629026_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime