Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629027_at:

>probe:Drosophila_2:1629027_at:442:255; Interrogation_Position=1433; Antisense; CACAGCGGACTGGTCATTGGCTTGG
>probe:Drosophila_2:1629027_at:730:549; Interrogation_Position=1457; Antisense; GGAGTGGGTCTCCTCTTCATCGGCA
>probe:Drosophila_2:1629027_at:461:639; Interrogation_Position=1488; Antisense; TCGGCATGCTCATCGTCTTCGGAAC
>probe:Drosophila_2:1629027_at:601:367; Interrogation_Position=1522; Antisense; GAATCCATCCTGGTTGCGAGGCAAT
>probe:Drosophila_2:1629027_at:127:593; Interrogation_Position=1614; Antisense; TGGGAGGTCCGATTGCTACTATTGA
>probe:Drosophila_2:1629027_at:13:255; Interrogation_Position=1639; Antisense; CAACAACGAGTACGTCACCGCCTAT
>probe:Drosophila_2:1629027_at:415:685; Interrogation_Position=1661; Antisense; TATCACCGTTACCTGGAGCAAGCAA
>probe:Drosophila_2:1629027_at:514:431; Interrogation_Position=1700; Antisense; GAGTCGAACAAGTATATCCGCCCGC
>probe:Drosophila_2:1629027_at:242:121; Interrogation_Position=1757; Antisense; AGCGATTATCCATTACCACTTCCGG
>probe:Drosophila_2:1629027_at:569:359; Interrogation_Position=1791; Antisense; GCAACGTATACGAGAGCTGTGAACT
>probe:Drosophila_2:1629027_at:225:293; Interrogation_Position=1806; Antisense; GCTGTGAACTGTACGAGGAACTTCC
>probe:Drosophila_2:1629027_at:245:383; Interrogation_Position=1823; Antisense; GAACTTCCGTAGACATATTTCGCCC
>probe:Drosophila_2:1629027_at:36:21; Interrogation_Position=1837; Antisense; ATATTTCGCCCAACGACGTGTACAA
>probe:Drosophila_2:1629027_at:724:481; Interrogation_Position=1911; Antisense; GTATTCAACACATTCCTTTTGCGAG

Paste this into a BLAST search page for me
CACAGCGGACTGGTCATTGGCTTGGGGAGTGGGTCTCCTCTTCATCGGCATCGGCATGCTCATCGTCTTCGGAACGAATCCATCCTGGTTGCGAGGCAATTGGGAGGTCCGATTGCTACTATTGACAACAACGAGTACGTCACCGCCTATTATCACCGTTACCTGGAGCAAGCAAGAGTCGAACAAGTATATCCGCCCGCAGCGATTATCCATTACCACTTCCGGGCAACGTATACGAGAGCTGTGAACTGCTGTGAACTGTACGAGGAACTTCCGAACTTCCGTAGACATATTTCGCCCATATTTCGCCCAACGACGTGTACAAGTATTCAACACATTCCTTTTGCGAG

Full Affymetrix probeset data:

Annotations for 1629027_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime