FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629029_at:

>probe:Drosophila_2:1629029_at:312:481; Interrogation_Position=1006; Antisense; GTTTGAGCAGCTCACGCAGCGACAT
>probe:Drosophila_2:1629029_at:262:43; Interrogation_Position=1029; Antisense; ATCGATGCTCCCTTCCGTAGTAGAG
>probe:Drosophila_2:1629029_at:573:677; Interrogation_Position=1046; Antisense; TAGTAGAGCTTCGACGGACGGCACC
>probe:Drosophila_2:1629029_at:302:503; Interrogation_Position=1076; Antisense; GTCCCGACCACGTAGATGGCGGTAT
>probe:Drosophila_2:1629029_at:447:417; Interrogation_Position=1140; Antisense; GAGCGACGGATGAGCATTTCCACCA
>probe:Drosophila_2:1629029_at:456:537; Interrogation_Position=687; Antisense; GGTCAGCGCCGATTCAGGGAGTTAT
>probe:Drosophila_2:1629029_at:531:477; Interrogation_Position=721; Antisense; GTTTTCACGAGATTTCCGTCAGAGA
>probe:Drosophila_2:1629029_at:385:477; Interrogation_Position=768; Antisense; GTTTTTCGCGATGTGTTTCGCTTCT
>probe:Drosophila_2:1629029_at:516:343; Interrogation_Position=787; Antisense; GCTTCTGGCGAGTCTTCAGCAAATT
>probe:Drosophila_2:1629029_at:326:27; Interrogation_Position=847; Antisense; ATACGGATGGAATCCTCACGCCCGA
>probe:Drosophila_2:1629029_at:154:11; Interrogation_Position=871; Antisense; ATTCGGGATCCTGTTCCTTCTACGA
>probe:Drosophila_2:1629029_at:633:635; Interrogation_Position=917; Antisense; TCGACATTCCTTTCTGGTCATCGGA
>probe:Drosophila_2:1629029_at:404:589; Interrogation_Position=931; Antisense; TGGTCATCGGAAGCGCCTGTTTGGA
>probe:Drosophila_2:1629029_at:126:535; Interrogation_Position=966; Antisense; GGTGACCATACGGAGTCTACGGATG

Paste this into a BLAST search page for me
GTTTGAGCAGCTCACGCAGCGACATATCGATGCTCCCTTCCGTAGTAGAGTAGTAGAGCTTCGACGGACGGCACCGTCCCGACCACGTAGATGGCGGTATGAGCGACGGATGAGCATTTCCACCAGGTCAGCGCCGATTCAGGGAGTTATGTTTTCACGAGATTTCCGTCAGAGAGTTTTTCGCGATGTGTTTCGCTTCTGCTTCTGGCGAGTCTTCAGCAAATTATACGGATGGAATCCTCACGCCCGAATTCGGGATCCTGTTCCTTCTACGATCGACATTCCTTTCTGGTCATCGGATGGTCATCGGAAGCGCCTGTTTGGAGGTGACCATACGGAGTCTACGGATG

Full Affymetrix probeset data:

Annotations for 1629029_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720