Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629033_at:

>probe:Drosophila_2:1629033_at:683:595; Interrogation_Position=1577; Antisense; TGTGGTCCAGCTTCATCAGCAGCTA
>probe:Drosophila_2:1629033_at:432:113; Interrogation_Position=1594; Antisense; AGCAGCTATGCCCAGTTGTGCGTGC
>probe:Drosophila_2:1629033_at:720:205; Interrogation_Position=1654; Antisense; AAGCGAATCGTTTGCCACAATCCGT
>probe:Drosophila_2:1629033_at:505:235; Interrogation_Position=1672; Antisense; AATCCGTATGGCTTCAGTCCGCGGC
>probe:Drosophila_2:1629033_at:64:307; Interrogation_Position=1750; Antisense; CCTTGCTATCATCTTCCTAGAGACA
>probe:Drosophila_2:1629033_at:680:675; Interrogation_Position=1767; Antisense; TAGAGACAATAACCGACCTGCGATT
>probe:Drosophila_2:1629033_at:101:131; Interrogation_Position=1782; Antisense; ACCTGCGATTCCGAGGCGCGGTAAA
>probe:Drosophila_2:1629033_at:727:517; Interrogation_Position=1826; Antisense; GTGGAAGCCTCTTTAAATTCTTACG
>probe:Drosophila_2:1629033_at:552:693; Interrogation_Position=1907; Antisense; TTTAGCCTCTACAGTGTACGCCATA
>probe:Drosophila_2:1629033_at:473:461; Interrogation_Position=1939; Antisense; GATTTTCCACACTAGACTTACAACT
>probe:Drosophila_2:1629033_at:652:283; Interrogation_Position=2024; Antisense; CTGTATTATATTTTGGGCTCTCCCC
>probe:Drosophila_2:1629033_at:343:337; Interrogation_Position=2040; Antisense; GCTCTCCCCTTTGCGAAATGCGAGA
>probe:Drosophila_2:1629033_at:300:325; Interrogation_Position=2059; Antisense; GCGAGATTCGTGGTCTTATTCCAAA
>probe:Drosophila_2:1629033_at:477:169; Interrogation_Position=2081; Antisense; AAAGGCCACAACTATGCCCGATATT

Paste this into a BLAST search page for me
TGTGGTCCAGCTTCATCAGCAGCTAAGCAGCTATGCCCAGTTGTGCGTGCAAGCGAATCGTTTGCCACAATCCGTAATCCGTATGGCTTCAGTCCGCGGCCCTTGCTATCATCTTCCTAGAGACATAGAGACAATAACCGACCTGCGATTACCTGCGATTCCGAGGCGCGGTAAAGTGGAAGCCTCTTTAAATTCTTACGTTTAGCCTCTACAGTGTACGCCATAGATTTTCCACACTAGACTTACAACTCTGTATTATATTTTGGGCTCTCCCCGCTCTCCCCTTTGCGAAATGCGAGAGCGAGATTCGTGGTCTTATTCCAAAAAAGGCCACAACTATGCCCGATATT

Full Affymetrix probeset data:

Annotations for 1629033_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime