Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629034_at:

>probe:Drosophila_2:1629034_at:461:87; Interrogation_Position=1801; Antisense; AGTCTGCTCTGTCGTTCTGTGAAGC
>probe:Drosophila_2:1629034_at:112:263; Interrogation_Position=1825; Antisense; CAGCGTGTTGTTTCGGAGTGCAGCA
>probe:Drosophila_2:1629034_at:56:429; Interrogation_Position=1883; Antisense; GAGTAACCCAAACCTACGATGCCGG
>probe:Drosophila_2:1629034_at:634:345; Interrogation_Position=1913; Antisense; GCATCTACTTCTACTTTGGATTCCG
>probe:Drosophila_2:1629034_at:725:701; Interrogation_Position=1967; Antisense; TTTTCGAGGCCATCGAGCACAGTGC
>probe:Drosophila_2:1629034_at:235:293; Interrogation_Position=1995; Antisense; CGATGAGATACTGTCCTGCGGCGGA
>probe:Drosophila_2:1629034_at:213:455; Interrogation_Position=2049; Antisense; GATACGAAGCCATTGGTACCGCAAT
>probe:Drosophila_2:1629034_at:242:349; Interrogation_Position=2090; Antisense; GCAGTTCACTATATTCGGCGGCCAA
>probe:Drosophila_2:1629034_at:452:121; Interrogation_Position=2114; Antisense; AGCGGCATCTCGATCCGAAGAATAT
>probe:Drosophila_2:1629034_at:178:363; Interrogation_Position=2133; Antisense; GAATATCTTTGCTCTCGGTAACCTT
>probe:Drosophila_2:1629034_at:46:85; Interrogation_Position=2247; Antisense; AGTGCGCTTAGTTCGTTTACTAGTC
>probe:Drosophila_2:1629034_at:517:669; Interrogation_Position=2282; Antisense; TACTGATTTTCCTAGTCGCTCTTGG
>probe:Drosophila_2:1629034_at:38:535; Interrogation_Position=2314; Antisense; GGTCTCCAGTTCTTTTGTAGCGGGC
>probe:Drosophila_2:1629034_at:187:119; Interrogation_Position=2332; Antisense; AGCGGGCTCATGTTTTCTATGGGTT

Paste this into a BLAST search page for me
AGTCTGCTCTGTCGTTCTGTGAAGCCAGCGTGTTGTTTCGGAGTGCAGCAGAGTAACCCAAACCTACGATGCCGGGCATCTACTTCTACTTTGGATTCCGTTTTCGAGGCCATCGAGCACAGTGCCGATGAGATACTGTCCTGCGGCGGAGATACGAAGCCATTGGTACCGCAATGCAGTTCACTATATTCGGCGGCCAAAGCGGCATCTCGATCCGAAGAATATGAATATCTTTGCTCTCGGTAACCTTAGTGCGCTTAGTTCGTTTACTAGTCTACTGATTTTCCTAGTCGCTCTTGGGGTCTCCAGTTCTTTTGTAGCGGGCAGCGGGCTCATGTTTTCTATGGGTT

Full Affymetrix probeset data:

Annotations for 1629034_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime