Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629035_at:

>probe:Drosophila_2:1629035_at:364:263; Interrogation_Position=2518; Antisense; CAGAGTTCCCTGGTCAGTCAAGTGC
>probe:Drosophila_2:1629035_at:290:287; Interrogation_Position=2527; Antisense; CTGGTCAGTCAAGTGCCGGTGCATA
>probe:Drosophila_2:1629035_at:401:305; Interrogation_Position=2542; Antisense; CCGGTGCATACGACCTTGACGTTAA
>probe:Drosophila_2:1629035_at:179:409; Interrogation_Position=2559; Antisense; GACGTTAAGGCCCAACAGCAGCTGC
>probe:Drosophila_2:1629035_at:640:351; Interrogation_Position=2582; Antisense; GCAGCACCATCATCAATTTCGGTGG
>probe:Drosophila_2:1629035_at:552:121; Interrogation_Position=2619; Antisense; AGCGGACTCCGATGAGCAGCCACCG
>probe:Drosophila_2:1629035_at:600:569; Interrogation_Position=2713; Antisense; GGCATCACCATCGTTGAGCACATAG
>probe:Drosophila_2:1629035_at:532:421; Interrogation_Position=2728; Antisense; GAGCACATAGCTATAACACCAACCA
>probe:Drosophila_2:1629035_at:682:71; Interrogation_Position=2782; Antisense; AGGCTCTTCGACATGTTCTTCCGCA
>probe:Drosophila_2:1629035_at:658:117; Interrogation_Position=2806; Antisense; AGCTCCAAGAAACTGCAGGCGGGCT
>probe:Drosophila_2:1629035_at:226:265; Interrogation_Position=2839; Antisense; CAGAGTTTGCCCACTGAGGTCTAAA
>probe:Drosophila_2:1629035_at:12:181; Interrogation_Position=2902; Antisense; AAACACTAAACTTGCTTGCTGAAGA
>probe:Drosophila_2:1629035_at:706:211; Interrogation_Position=2997; Antisense; AAGACCAGATCATGCTGTCCTAGAA
>probe:Drosophila_2:1629035_at:32:599; Interrogation_Position=3012; Antisense; TGTCCTAGAAGCTTCTCATGCCAAA

Paste this into a BLAST search page for me
CAGAGTTCCCTGGTCAGTCAAGTGCCTGGTCAGTCAAGTGCCGGTGCATACCGGTGCATACGACCTTGACGTTAAGACGTTAAGGCCCAACAGCAGCTGCGCAGCACCATCATCAATTTCGGTGGAGCGGACTCCGATGAGCAGCCACCGGGCATCACCATCGTTGAGCACATAGGAGCACATAGCTATAACACCAACCAAGGCTCTTCGACATGTTCTTCCGCAAGCTCCAAGAAACTGCAGGCGGGCTCAGAGTTTGCCCACTGAGGTCTAAAAAACACTAAACTTGCTTGCTGAAGAAAGACCAGATCATGCTGTCCTAGAATGTCCTAGAAGCTTCTCATGCCAAA

Full Affymetrix probeset data:

Annotations for 1629035_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime