Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629036_at:

>probe:Drosophila_2:1629036_at:488:711; Interrogation_Position=1008; Antisense; TTCTACTTGGGCCACTGGCAGGAAG
>probe:Drosophila_2:1629036_at:712:173; Interrogation_Position=1040; Antisense; AAAGCTGTTCAGCTTTGGCGGCCTC
>probe:Drosophila_2:1629036_at:617:639; Interrogation_Position=1063; Antisense; TCGGCGTCTGGACCATCATCGATGT
>probe:Drosophila_2:1629036_at:50:263; Interrogation_Position=1117; Antisense; CAGCGGATGGCTCACTTTACATATA
>probe:Drosophila_2:1629036_at:286:659; Interrogation_Position=1170; Antisense; TAAGCTAACTTTTCCATTACAGTGT
>probe:Drosophila_2:1629036_at:37:677; Interrogation_Position=1320; Antisense; TAGCACAATTCTTTGATCGTATCAA
>probe:Drosophila_2:1629036_at:362:243; Interrogation_Position=1363; Antisense; AATATAACCATCTCTTTCTCGTTCC
>probe:Drosophila_2:1629036_at:160:715; Interrogation_Position=1378; Antisense; TTCTCGTTCCTGTAAGATCAGACAA
>probe:Drosophila_2:1629036_at:463:31; Interrogation_Position=850; Antisense; ATAAGCTATTCCGTACCAACTGCAC
>probe:Drosophila_2:1629036_at:372:195; Interrogation_Position=867; Antisense; AACTGCACCGTGCACCATGATGTGC
>probe:Drosophila_2:1629036_at:236:443; Interrogation_Position=885; Antisense; GATGTGCTCTGCCTCGGCAATCGAT
>probe:Drosophila_2:1629036_at:449:327; Interrogation_Position=926; Antisense; GCGATGCAACTGGACGCAGGGCTAT
>probe:Drosophila_2:1629036_at:465:685; Interrogation_Position=948; Antisense; TATCGGTGGAGCACAGCCCTGCTGA
>probe:Drosophila_2:1629036_at:301:729; Interrogation_Position=994; Antisense; TTGGAGCCGATCGATTCTACTTGGG

Paste this into a BLAST search page for me
TTCTACTTGGGCCACTGGCAGGAAGAAAGCTGTTCAGCTTTGGCGGCCTCTCGGCGTCTGGACCATCATCGATGTCAGCGGATGGCTCACTTTACATATATAAGCTAACTTTTCCATTACAGTGTTAGCACAATTCTTTGATCGTATCAAAATATAACCATCTCTTTCTCGTTCCTTCTCGTTCCTGTAAGATCAGACAAATAAGCTATTCCGTACCAACTGCACAACTGCACCGTGCACCATGATGTGCGATGTGCTCTGCCTCGGCAATCGATGCGATGCAACTGGACGCAGGGCTATTATCGGTGGAGCACAGCCCTGCTGATTGGAGCCGATCGATTCTACTTGGG

Full Affymetrix probeset data:

Annotations for 1629036_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime