FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629037_at:

>probe:Drosophila_2:1629037_at:270:583; Interrogation_Position=126; Antisense; TGGCTGGGCGGCTGGTGAGTCTAAC
>probe:Drosophila_2:1629037_at:702:285; Interrogation_Position=129; Antisense; CTGGGCGGCTGGTGAGTCTAACGGT
>probe:Drosophila_2:1629037_at:400:55; Interrogation_Position=13; Antisense; ATGAACATTGCAGTGGCTGCAAGTT
>probe:Drosophila_2:1629037_at:224:619; Interrogation_Position=21; Antisense; TGCAGTGGCTGCAAGTTGCTGCTGC
>probe:Drosophila_2:1629037_at:583:83; Interrogation_Position=24; Antisense; AGTGGCTGCAAGTTGCTGCTGCGCT
>probe:Drosophila_2:1629037_at:34:471; Interrogation_Position=250; Antisense; GTTAGAGGAACCATGCGTACGGTCC
>probe:Drosophila_2:1629037_at:404:677; Interrogation_Position=252; Antisense; TAGAGGAACCATGCGTACGGTCCGC
>probe:Drosophila_2:1629037_at:268:73; Interrogation_Position=255; Antisense; AGGAACCATGCGTACGGTCCGCGAA
>probe:Drosophila_2:1629037_at:48:381; Interrogation_Position=257; Antisense; GAACCATGCGTACGGTCCGCGAATA
>probe:Drosophila_2:1629037_at:426:583; Interrogation_Position=26; Antisense; TGGCTGCAAGTTGCTGCTGCGCTGT
>probe:Drosophila_2:1629037_at:483:335; Interrogation_Position=28; Antisense; GCTGCAAGTTGCTGCTGCGCTGTGC
>probe:Drosophila_2:1629037_at:363:251; Interrogation_Position=32; Antisense; CAAGTTGCTGCTGCGCTGTGCTGTT
>probe:Drosophila_2:1629037_at:48:621; Interrogation_Position=74; Antisense; TGCTGCGGGGAAGCTGCTATTTGCA
>probe:Drosophila_2:1629037_at:157:277; Interrogation_Position=90; Antisense; CTATTTGCAGCAAGAGTGGGAGATG

Paste this into a BLAST search page for me
TGGCTGGGCGGCTGGTGAGTCTAACCTGGGCGGCTGGTGAGTCTAACGGTATGAACATTGCAGTGGCTGCAAGTTTGCAGTGGCTGCAAGTTGCTGCTGCAGTGGCTGCAAGTTGCTGCTGCGCTGTTAGAGGAACCATGCGTACGGTCCTAGAGGAACCATGCGTACGGTCCGCAGGAACCATGCGTACGGTCCGCGAAGAACCATGCGTACGGTCCGCGAATATGGCTGCAAGTTGCTGCTGCGCTGTGCTGCAAGTTGCTGCTGCGCTGTGCCAAGTTGCTGCTGCGCTGTGCTGTTTGCTGCGGGGAAGCTGCTATTTGCACTATTTGCAGCAAGAGTGGGAGATG

Full Affymetrix probeset data:

Annotations for 1629037_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720