Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629038_at:

>probe:Drosophila_2:1629038_at:101:533; Interrogation_Position=113; Antisense; GGGTGTGTGTGCTCTTTCGAAATGC
>probe:Drosophila_2:1629038_at:435:281; Interrogation_Position=145; Antisense; CTCGGTCGGATACGCAAGCTTTCAA
>probe:Drosophila_2:1629038_at:554:245; Interrogation_Position=213; Antisense; AATTATCTGCTCTTTATCGCCGAGA
>probe:Drosophila_2:1629038_at:379:107; Interrogation_Position=235; Antisense; AGAACTTTTTGTCTCCATCGGCGTT
>probe:Drosophila_2:1629038_at:20:701; Interrogation_Position=273; Antisense; TTTTAATGGCCACGCACACAGTTAC
>probe:Drosophila_2:1629038_at:7:701; Interrogation_Position=337; Antisense; TTTTTCATCTCTCTTCATCTATCTA
>probe:Drosophila_2:1629038_at:88:39; Interrogation_Position=357; Antisense; ATCTACCCATCTATCTGTGTATCTG
>probe:Drosophila_2:1629038_at:591:513; Interrogation_Position=373; Antisense; GTGTATCTGCATCCCAAAATGTAGC
>probe:Drosophila_2:1629038_at:90:373; Interrogation_Position=399; Antisense; GAAGTGCACACGACGTTTGTATCTA
>probe:Drosophila_2:1629038_at:593:21; Interrogation_Position=471; Antisense; ATAGTCAACGACAGGTTCCGCTGCA
>probe:Drosophila_2:1629038_at:247:471; Interrogation_Position=485; Antisense; GTTCCGCTGCAGTTGTTGTAGGTAT
>probe:Drosophila_2:1629038_at:345:597; Interrogation_Position=603; Antisense; TGTGCGCTTACCTGTGACGTATTAA
>probe:Drosophila_2:1629038_at:482:337; Interrogation_Position=61; Antisense; GCTCGAGCGGTGACGTTATTGTGTT
>probe:Drosophila_2:1629038_at:578:603; Interrogation_Position=82; Antisense; TGTTGTCTTCACCTGATTTTCGCAA

Paste this into a BLAST search page for me
GGGTGTGTGTGCTCTTTCGAAATGCCTCGGTCGGATACGCAAGCTTTCAAAATTATCTGCTCTTTATCGCCGAGAAGAACTTTTTGTCTCCATCGGCGTTTTTTAATGGCCACGCACACAGTTACTTTTTCATCTCTCTTCATCTATCTAATCTACCCATCTATCTGTGTATCTGGTGTATCTGCATCCCAAAATGTAGCGAAGTGCACACGACGTTTGTATCTAATAGTCAACGACAGGTTCCGCTGCAGTTCCGCTGCAGTTGTTGTAGGTATTGTGCGCTTACCTGTGACGTATTAAGCTCGAGCGGTGACGTTATTGTGTTTGTTGTCTTCACCTGATTTTCGCAA

Full Affymetrix probeset data:

Annotations for 1629038_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime