FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629040_at:

>probe:Drosophila_2:1629040_at:442:183; Interrogation_Position=1024; Antisense; AAAAGCTCTATTTCGCGGTATCCTG
>probe:Drosophila_2:1629040_at:506:539; Interrogation_Position=1040; Antisense; GGTATCCTGCCAATTCTACTTCGTG
>probe:Drosophila_2:1629040_at:472:415; Interrogation_Position=591; Antisense; GAGCCTTGGCCGGAGTTTGTTCTGC
>probe:Drosophila_2:1629040_at:497:153; Interrogation_Position=623; Antisense; ACAGTGCCCACCGATCGTATAAAAG
>probe:Drosophila_2:1629040_at:53:185; Interrogation_Position=643; Antisense; AAAAGTCCTTCTGCAGACGCAAACC
>probe:Drosophila_2:1629040_at:275:197; Interrogation_Position=674; Antisense; AACGGACCTCTGCTCTACAATGGAA
>probe:Drosophila_2:1629040_at:546:569; Interrogation_Position=734; Antisense; GGCATTCGGAGCCTCTTCAAGGGAA
>probe:Drosophila_2:1629040_at:367:51; Interrogation_Position=760; Antisense; ATGCGCGTGCATTCTGAGAGACTCG
>probe:Drosophila_2:1629040_at:5:667; Interrogation_Position=797; Antisense; TACTTTGTGACCTACGAATTCCTAC
>probe:Drosophila_2:1629040_at:555:151; Interrogation_Position=866; Antisense; ACATCAACTATTCTGTCCGGCGGAA
>probe:Drosophila_2:1629040_at:294:197; Interrogation_Position=889; Antisense; AACGGCGGGCATTGTGTTTTGGACT
>probe:Drosophila_2:1629040_at:374:315; Interrogation_Position=917; Antisense; GCCGTGCCGTTCGATGTACTTAAAA
>probe:Drosophila_2:1629040_at:163:355; Interrogation_Position=976; Antisense; GCACGGCATTCGCAGCGTTTTTAGA
>probe:Drosophila_2:1629040_at:180:477; Interrogation_Position=992; Antisense; GTTTTTAGAAACCTCATGGCCACAG

Paste this into a BLAST search page for me
AAAAGCTCTATTTCGCGGTATCCTGGGTATCCTGCCAATTCTACTTCGTGGAGCCTTGGCCGGAGTTTGTTCTGCACAGTGCCCACCGATCGTATAAAAGAAAAGTCCTTCTGCAGACGCAAACCAACGGACCTCTGCTCTACAATGGAAGGCATTCGGAGCCTCTTCAAGGGAAATGCGCGTGCATTCTGAGAGACTCGTACTTTGTGACCTACGAATTCCTACACATCAACTATTCTGTCCGGCGGAAAACGGCGGGCATTGTGTTTTGGACTGCCGTGCCGTTCGATGTACTTAAAAGCACGGCATTCGCAGCGTTTTTAGAGTTTTTAGAAACCTCATGGCCACAG

Full Affymetrix probeset data:

Annotations for 1629040_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720