FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629041_at:

>probe:Drosophila_2:1629041_at:577:281; Interrogation_Position=115; Antisense; CGGAAGCCCGCATCCCAGGGCTGGA
>probe:Drosophila_2:1629041_at:633:267; Interrogation_Position=130; Antisense; CAGGGCTGGACACTCTACCTCATCG
>probe:Drosophila_2:1629041_at:426:619; Interrogation_Position=160; Antisense; TGCTTCGCATTACTCCTGCTCATGA
>probe:Drosophila_2:1629041_at:172:15; Interrogation_Position=168; Antisense; ATTACTCCTGCTCATGATCATCTAT
>probe:Drosophila_2:1629041_at:464:647; Interrogation_Position=185; Antisense; TCATCTATATGATCCATGTGGCCAG
>probe:Drosophila_2:1629041_at:605:447; Interrogation_Position=195; Antisense; GATCCATGTGGCCAGAAGATATAAC
>probe:Drosophila_2:1629041_at:596:233; Interrogation_Position=20; Antisense; AATGCCAAATGCTCGAGATCCTGGA
>probe:Drosophila_2:1629041_at:293:23; Interrogation_Position=213; Antisense; ATATAACCATGTTCGAGCCTACGGC
>probe:Drosophila_2:1629041_at:204:623; Interrogation_Position=247; Antisense; TGCGGATCCACTTTGTTCTACAGCT
>probe:Drosophila_2:1629041_at:428:471; Interrogation_Position=261; Antisense; GTTCTACAGCTACAGCGACTGCGAT
>probe:Drosophila_2:1629041_at:24:399; Interrogation_Position=43; Antisense; GACAAAGTGCGCTCCTGCGATTGCT
>probe:Drosophila_2:1629041_at:557:325; Interrogation_Position=59; Antisense; GCGATTGCTGCCACAAAAGAAGGCT
>probe:Drosophila_2:1629041_at:22:71; Interrogation_Position=79; Antisense; AGGCTAAACAACTGCCGGATGGTTA
>probe:Drosophila_2:1629041_at:480:253; Interrogation_Position=87; Antisense; CAACTGCCGGATGGTTAAGTCTGGA

Paste this into a BLAST search page for me
CGGAAGCCCGCATCCCAGGGCTGGACAGGGCTGGACACTCTACCTCATCGTGCTTCGCATTACTCCTGCTCATGAATTACTCCTGCTCATGATCATCTATTCATCTATATGATCCATGTGGCCAGGATCCATGTGGCCAGAAGATATAACAATGCCAAATGCTCGAGATCCTGGAATATAACCATGTTCGAGCCTACGGCTGCGGATCCACTTTGTTCTACAGCTGTTCTACAGCTACAGCGACTGCGATGACAAAGTGCGCTCCTGCGATTGCTGCGATTGCTGCCACAAAAGAAGGCTAGGCTAAACAACTGCCGGATGGTTACAACTGCCGGATGGTTAAGTCTGGA

Full Affymetrix probeset data:

Annotations for 1629041_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720