Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629043_at:

>probe:Drosophila_2:1629043_at:50:645; Interrogation_Position=1028; Antisense; TCAGGGTTAACTTGTTGGGCCTCTT
>probe:Drosophila_2:1629043_at:656:517; Interrogation_Position=1044; Antisense; GGGCCTCTTCAATGTTTCCAACGAA
>probe:Drosophila_2:1629043_at:672:203; Interrogation_Position=591; Antisense; AAGCCTGGGAGTTCTCTATGCTGAG
>probe:Drosophila_2:1629043_at:422:655; Interrogation_Position=624; Antisense; TAATCTTCGCTTTGAGTCAGGCTTC
>probe:Drosophila_2:1629043_at:683:495; Interrogation_Position=639; Antisense; GTCAGGCTTCCAAACGGCATTTTTA
>probe:Drosophila_2:1629043_at:91:77; Interrogation_Position=710; Antisense; AGGAGATATCCTCTGTGGTTACCTC
>probe:Drosophila_2:1629043_at:499:473; Interrogation_Position=727; Antisense; GTTACCTCCTTGCAGGACATTTTCA
>probe:Drosophila_2:1629043_at:192:601; Interrogation_Position=753; Antisense; TGTACACCTATTTTTGAGCGCACTC
>probe:Drosophila_2:1629043_at:303:399; Interrogation_Position=780; Antisense; GACACTTCTGCAAGTTCTAGTCGTT
>probe:Drosophila_2:1629043_at:99:679; Interrogation_Position=827; Antisense; TAGGGTTTTCTGACTTTCGGATTTG
>probe:Drosophila_2:1629043_at:16:641; Interrogation_Position=843; Antisense; TCGGATTTGGTCATTCTCGCTTAAA
>probe:Drosophila_2:1629043_at:367:193; Interrogation_Position=930; Antisense; AACTCGGGAACGTGCTCTGGATATT
>probe:Drosophila_2:1629043_at:248:335; Interrogation_Position=943; Antisense; GCTCTGGATATTTTCCTCGTTGGAA
>probe:Drosophila_2:1629043_at:7:397; Interrogation_Position=994; Antisense; GAAATATTTGTCACCCATCTCAACC

Paste this into a BLAST search page for me
TCAGGGTTAACTTGTTGGGCCTCTTGGGCCTCTTCAATGTTTCCAACGAAAAGCCTGGGAGTTCTCTATGCTGAGTAATCTTCGCTTTGAGTCAGGCTTCGTCAGGCTTCCAAACGGCATTTTTAAGGAGATATCCTCTGTGGTTACCTCGTTACCTCCTTGCAGGACATTTTCATGTACACCTATTTTTGAGCGCACTCGACACTTCTGCAAGTTCTAGTCGTTTAGGGTTTTCTGACTTTCGGATTTGTCGGATTTGGTCATTCTCGCTTAAAAACTCGGGAACGTGCTCTGGATATTGCTCTGGATATTTTCCTCGTTGGAAGAAATATTTGTCACCCATCTCAACC

Full Affymetrix probeset data:

Annotations for 1629043_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime