FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629044_at:

>probe:Drosophila_2:1629044_at:697:711; Interrogation_Position=1464; Antisense; TTGCTTTCGCTGCTGCGGAAGGATT
>probe:Drosophila_2:1629044_at:492:153; Interrogation_Position=1555; Antisense; ACATGTACCTGCCAGTCGACGTGGA
>probe:Drosophila_2:1629044_at:703:141; Interrogation_Position=1620; Antisense; ACTGCCGCCGATGCGATGGATGATG
>probe:Drosophila_2:1629044_at:543:73; Interrogation_Position=1652; Antisense; AGGACTCTGTCCCTTGGGTGACAAG
>probe:Drosophila_2:1629044_at:397:629; Interrogation_Position=1722; Antisense; TCCACGCTCCAAATGGCTCAGAATG
>probe:Drosophila_2:1629044_at:613:47; Interrogation_Position=1744; Antisense; ATGCCAATGGGCTGTCCACGGAACC
>probe:Drosophila_2:1629044_at:613:377; Interrogation_Position=1764; Antisense; GAACCCGAACCCGATACGGATGTGG
>probe:Drosophila_2:1629044_at:135:605; Interrogation_Position=1797; Antisense; TGATTGGAGCTCGTGGAGTCACCCA
>probe:Drosophila_2:1629044_at:381:259; Interrogation_Position=1820; Antisense; CACGGGTTGCATTCTGGGACACGCT
>probe:Drosophila_2:1629044_at:577:299; Interrogation_Position=1847; Antisense; CGCGTTGGCTGCATCCGGCTGAATG
>probe:Drosophila_2:1629044_at:86:235; Interrogation_Position=1868; Antisense; AATGCCGACTGATTAGCCGCCGGGA
>probe:Drosophila_2:1629044_at:233:683; Interrogation_Position=1910; Antisense; TATGACACTGTGGACATCCTGGCCT
>probe:Drosophila_2:1629044_at:34:719; Interrogation_Position=1973; Antisense; TTCCTGCAGGTGGTACTGCCAACAA
>probe:Drosophila_2:1629044_at:361:675; Interrogation_Position=2010; Antisense; TAGACACACAAGAACTCACTGCCTT

Paste this into a BLAST search page for me
TTGCTTTCGCTGCTGCGGAAGGATTACATGTACCTGCCAGTCGACGTGGAACTGCCGCCGATGCGATGGATGATGAGGACTCTGTCCCTTGGGTGACAAGTCCACGCTCCAAATGGCTCAGAATGATGCCAATGGGCTGTCCACGGAACCGAACCCGAACCCGATACGGATGTGGTGATTGGAGCTCGTGGAGTCACCCACACGGGTTGCATTCTGGGACACGCTCGCGTTGGCTGCATCCGGCTGAATGAATGCCGACTGATTAGCCGCCGGGATATGACACTGTGGACATCCTGGCCTTTCCTGCAGGTGGTACTGCCAACAATAGACACACAAGAACTCACTGCCTT

Full Affymetrix probeset data:

Annotations for 1629044_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720