Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629046_a_at:

>probe:Drosophila_2:1629046_a_at:167:123; Interrogation_Position=117; Antisense; AGCGATCACTGTTACTACTGGCCGT
>probe:Drosophila_2:1629046_a_at:77:127; Interrogation_Position=145; Antisense; AGCCATCCTTTTCTGTGCTGCAGTG
>probe:Drosophila_2:1629046_a_at:310:625; Interrogation_Position=174; Antisense; TGCCCTCAAGACTAACCAAATCCGA
>probe:Drosophila_2:1629046_a_at:521:411; Interrogation_Position=254; Antisense; GACCTGGACGAGAGCACCGGAATCC
>probe:Drosophila_2:1629046_a_at:328:33; Interrogation_Position=284; Antisense; ATCAAACGATCTGCCAAGGATGCCA
>probe:Drosophila_2:1629046_a_at:637:77; Interrogation_Position=300; Antisense; AGGATGCCAGCAGCTCATCTGAGGA
>probe:Drosophila_2:1629046_a_at:463:107; Interrogation_Position=354; Antisense; AGAACAAGGCGGACAGCTCCGGCGA
>probe:Drosophila_2:1629046_a_at:691:71; Interrogation_Position=390; Antisense; AGGAAAAGACAACACCAGCTGCGGT
>probe:Drosophila_2:1629046_a_at:433:179; Interrogation_Position=420; Antisense; AAACAACTACGGAGCACACTGCTAG
>probe:Drosophila_2:1629046_a_at:394:103; Interrogation_Position=501; Antisense; AGACGCCAGGCTGCCGATCAGAAAT
>probe:Drosophila_2:1629046_a_at:728:105; Interrogation_Position=520; Antisense; AGAAATCCAGCGATGCGCCGGACCT
>probe:Drosophila_2:1629046_a_at:704:285; Interrogation_Position=589; Antisense; CTGTGGCGGAGCTTTTGAAGGACAA
>probe:Drosophila_2:1629046_a_at:249:559; Interrogation_Position=608; Antisense; GGACAAGGACAACACCAGCATCGAA
>probe:Drosophila_2:1629046_a_at:655:113; Interrogation_Position=624; Antisense; AGCATCGAAGACTACGCCCAGGGAT

Paste this into a BLAST search page for me
AGCGATCACTGTTACTACTGGCCGTAGCCATCCTTTTCTGTGCTGCAGTGTGCCCTCAAGACTAACCAAATCCGAGACCTGGACGAGAGCACCGGAATCCATCAAACGATCTGCCAAGGATGCCAAGGATGCCAGCAGCTCATCTGAGGAAGAACAAGGCGGACAGCTCCGGCGAAGGAAAAGACAACACCAGCTGCGGTAAACAACTACGGAGCACACTGCTAGAGACGCCAGGCTGCCGATCAGAAATAGAAATCCAGCGATGCGCCGGACCTCTGTGGCGGAGCTTTTGAAGGACAAGGACAAGGACAACACCAGCATCGAAAGCATCGAAGACTACGCCCAGGGAT

Full Affymetrix probeset data:

Annotations for 1629046_a_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime