FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629049_at:

>probe:Drosophila_2:1629049_at:151:511; Interrogation_Position=305; Antisense; GTGAACACAATTTTCTGGCTTCCTT
>probe:Drosophila_2:1629049_at:652:639; Interrogation_Position=318; Antisense; TCTGGCTTCCTTGACGCAGTTAAAG
>probe:Drosophila_2:1629049_at:79:445; Interrogation_Position=374; Antisense; GATCATTTAGGATGCCTCCTGGGCA
>probe:Drosophila_2:1629049_at:5:553; Interrogation_Position=410; Antisense; GGAGCTCCTACTGCGAACGCGAGTA
>probe:Drosophila_2:1629049_at:583:91; Interrogation_Position=431; Antisense; AGTATCGAGATTGTCGCCTGCAGAC
>probe:Drosophila_2:1629049_at:669:617; Interrogation_Position=449; Antisense; TGCAGACCTGTTACGTTCAATCGCC
>probe:Drosophila_2:1629049_at:243:345; Interrogation_Position=475; Antisense; GCATATCCTGGCCTATATCCTCGGG
>probe:Drosophila_2:1629049_at:451:363; Interrogation_Position=504; Antisense; GAATTGCCGCTATAAGCTGCACACT
>probe:Drosophila_2:1629049_at:453:145; Interrogation_Position=526; Antisense; ACTCGCCAGCCATATATCAAATTGT
>probe:Drosophila_2:1629049_at:475:583; Interrogation_Position=640; Antisense; TGGCATTCTAAAAACTTTTCCCCAG
>probe:Drosophila_2:1629049_at:299:471; Interrogation_Position=669; Antisense; GTTCGTGGAGGGTACTTTCTGCAGA
>probe:Drosophila_2:1629049_at:247:667; Interrogation_Position=706; Antisense; TACTCTGGCATCGAGTTTCACACAG
>probe:Drosophila_2:1629049_at:382:241; Interrogation_Position=734; Antisense; AATACTGCACCTTGAGCATCGTTGC
>probe:Drosophila_2:1629049_at:405:717; Interrogation_Position=787; Antisense; TTCGACGGCCGGATGCCAAACAAAT

Paste this into a BLAST search page for me
GTGAACACAATTTTCTGGCTTCCTTTCTGGCTTCCTTGACGCAGTTAAAGGATCATTTAGGATGCCTCCTGGGCAGGAGCTCCTACTGCGAACGCGAGTAAGTATCGAGATTGTCGCCTGCAGACTGCAGACCTGTTACGTTCAATCGCCGCATATCCTGGCCTATATCCTCGGGGAATTGCCGCTATAAGCTGCACACTACTCGCCAGCCATATATCAAATTGTTGGCATTCTAAAAACTTTTCCCCAGGTTCGTGGAGGGTACTTTCTGCAGATACTCTGGCATCGAGTTTCACACAGAATACTGCACCTTGAGCATCGTTGCTTCGACGGCCGGATGCCAAACAAAT

Full Affymetrix probeset data:

Annotations for 1629049_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720