FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629050_at:

>probe:Drosophila_2:1629050_at:367:153; Interrogation_Position=244; Antisense; ACATGGGTACTAACTGCTGCTCATT
>probe:Drosophila_2:1629050_at:158:7; Interrogation_Position=266; Antisense; ATTGCACCAAAGGAGCCTCTTCCGT
>probe:Drosophila_2:1629050_at:232:389; Interrogation_Position=336; Antisense; GAAAAAGGTCTCCAGCTCCAAGTTT
>probe:Drosophila_2:1629050_at:582:217; Interrogation_Position=355; Antisense; AAGTTTGTGCAGCATGCCGGCTACA
>probe:Drosophila_2:1629050_at:296:31; Interrogation_Position=445; Antisense; ATAAATAAGATTGCCCTGCCCGCCA
>probe:Drosophila_2:1629050_at:533:399; Interrogation_Position=497; Antisense; GACAGACTGCAGTGGCTTCCGGATG
>probe:Drosophila_2:1629050_at:599:497; Interrogation_Position=583; Antisense; GTCATTACCAATGCTGTGTGTCAGA
>probe:Drosophila_2:1629050_at:192:123; Interrogation_Position=610; Antisense; ACCTTTGGGTCATCTGTGGTCACCA
>probe:Drosophila_2:1629050_at:617:429; Interrogation_Position=638; Antisense; GAGTTATCTGCGTGGAGTCCATCAA
>probe:Drosophila_2:1629050_at:459:159; Interrogation_Position=662; Antisense; ACAAGAAGTCGACCTGTCAGGGCGA
>probe:Drosophila_2:1629050_at:342:581; Interrogation_Position=690; Antisense; TGGCGGTCCGTTGGCTTTGAACAAT
>probe:Drosophila_2:1629050_at:139:249; Interrogation_Position=720; Antisense; AATTGGTGTGACCTCGTTTGTGTCC
>probe:Drosophila_2:1629050_at:131:389; Interrogation_Position=759; Antisense; GAAAAATGCGCCTGCTGGTTTCACC
>probe:Drosophila_2:1629050_at:644:377; Interrogation_Position=813; Antisense; GAACCAGTCCGGTGTGTTTTATTAG

Paste this into a BLAST search page for me
ACATGGGTACTAACTGCTGCTCATTATTGCACCAAAGGAGCCTCTTCCGTGAAAAAGGTCTCCAGCTCCAAGTTTAAGTTTGTGCAGCATGCCGGCTACAATAAATAAGATTGCCCTGCCCGCCAGACAGACTGCAGTGGCTTCCGGATGGTCATTACCAATGCTGTGTGTCAGAACCTTTGGGTCATCTGTGGTCACCAGAGTTATCTGCGTGGAGTCCATCAAACAAGAAGTCGACCTGTCAGGGCGATGGCGGTCCGTTGGCTTTGAACAATAATTGGTGTGACCTCGTTTGTGTCCGAAAAATGCGCCTGCTGGTTTCACCGAACCAGTCCGGTGTGTTTTATTAG

Full Affymetrix probeset data:

Annotations for 1629050_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720