FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629053_at:

>probe:Drosophila_2:1629053_at:559:121; Interrogation_Position=5131; Antisense; AGCGGAGCGACTTGGTCATGCGACA
>probe:Drosophila_2:1629053_at:261:51; Interrogation_Position=5148; Antisense; ATGCGACAGCAGCTACTTCTTCAGC
>probe:Drosophila_2:1629053_at:68:649; Interrogation_Position=5168; Antisense; TCAGCAGCCCCAGAAACTAGAGTTT
>probe:Drosophila_2:1629053_at:129:681; Interrogation_Position=5231; Antisense; TATGGATCCGAGCAACTGGGCCACA
>probe:Drosophila_2:1629053_at:358:595; Interrogation_Position=5247; Antisense; TGGGCCACAAACTGGTCACCACTAG
>probe:Drosophila_2:1629053_at:96:497; Interrogation_Position=5347; Antisense; GTCAGACGCACAACCTTGCACAAGA
>probe:Drosophila_2:1629053_at:428:195; Interrogation_Position=5399; Antisense; AACTGGAGCTGCACTACACGGCGAA
>probe:Drosophila_2:1629053_at:268:241; Interrogation_Position=5437; Antisense; AATACGATCCTTTTACCTCGCCAAG
>probe:Drosophila_2:1629053_at:645:633; Interrogation_Position=5454; Antisense; TCGCCAAGCTCAATCTGGTCGGATA
>probe:Drosophila_2:1629053_at:222:545; Interrogation_Position=5474; Antisense; GGATACGTGGCGTCAGTCATCACAG
>probe:Drosophila_2:1629053_at:122:421; Interrogation_Position=5538; Antisense; GAGCAAGCTCACTGATCAAACCGAA
>probe:Drosophila_2:1629053_at:78:245; Interrogation_Position=5575; Antisense; AATTCTTACCACTTAGACACCTAGG
>probe:Drosophila_2:1629053_at:319:399; Interrogation_Position=5590; Antisense; GACACCTAGGATACGCGACGATGGA
>probe:Drosophila_2:1629053_at:702:381; Interrogation_Position=5616; Antisense; GAACGCTGAATGATCTTTTCCAATT

Paste this into a BLAST search page for me
AGCGGAGCGACTTGGTCATGCGACAATGCGACAGCAGCTACTTCTTCAGCTCAGCAGCCCCAGAAACTAGAGTTTTATGGATCCGAGCAACTGGGCCACATGGGCCACAAACTGGTCACCACTAGGTCAGACGCACAACCTTGCACAAGAAACTGGAGCTGCACTACACGGCGAAAATACGATCCTTTTACCTCGCCAAGTCGCCAAGCTCAATCTGGTCGGATAGGATACGTGGCGTCAGTCATCACAGGAGCAAGCTCACTGATCAAACCGAAAATTCTTACCACTTAGACACCTAGGGACACCTAGGATACGCGACGATGGAGAACGCTGAATGATCTTTTCCAATT

Full Affymetrix probeset data:

Annotations for 1629053_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720