FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629056_at:

>probe:Drosophila_2:1629056_at:52:509; Interrogation_Position=150; Antisense; GTGAATCCTGTGTGAGGCGTCTAAA
>probe:Drosophila_2:1629056_at:635:453; Interrogation_Position=19; Antisense; GATAAGTTCCCATAGTGAGAGAGTT
>probe:Drosophila_2:1629056_at:19:709; Interrogation_Position=194; Antisense; TTACCCCTCTTCAATAGAGAGTGCA
>probe:Drosophila_2:1629056_at:710:73; Interrogation_Position=224; Antisense; AGGACCGAATTATCTTGGCGCTGGA
>probe:Drosophila_2:1629056_at:296:703; Interrogation_Position=233; Antisense; TTATCTTGGCGCTGGAGGAACGTCG
>probe:Drosophila_2:1629056_at:392:383; Interrogation_Position=250; Antisense; GAACGTCGGACGCTGTGAGCTCTCC
>probe:Drosophila_2:1629056_at:646:511; Interrogation_Position=264; Antisense; GTGAGCTCTCCAAGCTAAATTGCTT
>probe:Drosophila_2:1629056_at:143:539; Interrogation_Position=290; Antisense; GGTTGGCAATCACCCATGAACTGTG
>probe:Drosophila_2:1629056_at:66:213; Interrogation_Position=315; Antisense; AAGACATTGCTATGAGGGCTGGTAT
>probe:Drosophila_2:1629056_at:621:381; Interrogation_Position=341; Antisense; GAACGCAGGCGTACTTAATAGTTAT
>probe:Drosophila_2:1629056_at:644:477; Interrogation_Position=41; Antisense; GTTTAAACTACAATAATGCGCCTGA
>probe:Drosophila_2:1629056_at:157:477; Interrogation_Position=71; Antisense; GTTTTAACCATCTTTTTCGCCATAT
>probe:Drosophila_2:1629056_at:207:701; Interrogation_Position=83; Antisense; TTTTTCGCCATATCGCTGACTCTGG
>probe:Drosophila_2:1629056_at:119:333; Interrogation_Position=97; Antisense; GCTGACTCTGGTTGCTGGTCAAGAT

Paste this into a BLAST search page for me
GTGAATCCTGTGTGAGGCGTCTAAAGATAAGTTCCCATAGTGAGAGAGTTTTACCCCTCTTCAATAGAGAGTGCAAGGACCGAATTATCTTGGCGCTGGATTATCTTGGCGCTGGAGGAACGTCGGAACGTCGGACGCTGTGAGCTCTCCGTGAGCTCTCCAAGCTAAATTGCTTGGTTGGCAATCACCCATGAACTGTGAAGACATTGCTATGAGGGCTGGTATGAACGCAGGCGTACTTAATAGTTATGTTTAAACTACAATAATGCGCCTGAGTTTTAACCATCTTTTTCGCCATATTTTTTCGCCATATCGCTGACTCTGGGCTGACTCTGGTTGCTGGTCAAGAT

Full Affymetrix probeset data:

Annotations for 1629056_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720