Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629058_a_at:

>probe:Drosophila_2:1629058_a_at:548:25; Interrogation_Position=181; Antisense; ATAGTCACGGGCCTGATCATATTCC
>probe:Drosophila_2:1629058_a_at:546:645; Interrogation_Position=197; Antisense; TCATATTCCTGATAGCTTCGCTGGG
>probe:Drosophila_2:1629058_a_at:151:499; Interrogation_Position=243; Antisense; GTCTCCAACGCTTCTAATTACTTTT
>probe:Drosophila_2:1629058_a_at:705:5; Interrogation_Position=259; Antisense; ATTACTTTTGCTGTCCTTTTGGCCG
>probe:Drosophila_2:1629058_a_at:622:729; Interrogation_Position=277; Antisense; TTGGCCGTCATCTTCATTGTGGAGC
>probe:Drosophila_2:1629058_a_at:402:481; Interrogation_Position=311; Antisense; GTATTGCGGCCAGCGTTTTCAAGAA
>probe:Drosophila_2:1629058_a_at:708:617; Interrogation_Position=365; Antisense; TGCAGGAGTCCATCAAGCGATCGAA
>probe:Drosophila_2:1629058_a_at:387:95; Interrogation_Position=428; Antisense; AGTTGATGTGCTGCGGAGTCGACTC
>probe:Drosophila_2:1629058_a_at:309:603; Interrogation_Position=502; Antisense; TGTTGTCAGCCGCAGTACATCGACT
>probe:Drosophila_2:1629058_a_at:433:27; Interrogation_Position=569; Antisense; ATAAGTACTTCCAGGTCGGCTGTGT
>probe:Drosophila_2:1629058_a_at:205:295; Interrogation_Position=615; Antisense; CGAGAAGAACGCCATCATCCTGATC
>probe:Drosophila_2:1629058_a_at:3:47; Interrogation_Position=631; Antisense; ATCCTGATCGGTGTGGGCATCGGCA
>probe:Drosophila_2:1629058_a_at:721:567; Interrogation_Position=646; Antisense; GGCATCGGCATTGCTTTTATCCAGA
>probe:Drosophila_2:1629058_a_at:134:705; Interrogation_Position=662; Antisense; TTATCCAGATTTTGGGCATCGTTCT

Paste this into a BLAST search page for me
ATAGTCACGGGCCTGATCATATTCCTCATATTCCTGATAGCTTCGCTGGGGTCTCCAACGCTTCTAATTACTTTTATTACTTTTGCTGTCCTTTTGGCCGTTGGCCGTCATCTTCATTGTGGAGCGTATTGCGGCCAGCGTTTTCAAGAATGCAGGAGTCCATCAAGCGATCGAAAGTTGATGTGCTGCGGAGTCGACTCTGTTGTCAGCCGCAGTACATCGACTATAAGTACTTCCAGGTCGGCTGTGTCGAGAAGAACGCCATCATCCTGATCATCCTGATCGGTGTGGGCATCGGCAGGCATCGGCATTGCTTTTATCCAGATTATCCAGATTTTGGGCATCGTTCT

Full Affymetrix probeset data:

Annotations for 1629058_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime