Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629062_at:

>probe:Drosophila_2:1629062_at:536:111; Interrogation_Position=2011; Antisense; AGCAACGAACTTAAGCAGCAACTAA
>probe:Drosophila_2:1629062_at:478:429; Interrogation_Position=2089; Antisense; GAGTTACTATTTCTAAACACACGCA
>probe:Drosophila_2:1629062_at:452:489; Interrogation_Position=2124; Antisense; GTACATACTGTATGCCTTCCTCTTT
>probe:Drosophila_2:1629062_at:182:715; Interrogation_Position=2140; Antisense; TTCCTCTTTCCATCGGAAGTCGACT
>probe:Drosophila_2:1629062_at:84:27; Interrogation_Position=2199; Antisense; ATACCAAATCATACTTAGCAGCGAG
>probe:Drosophila_2:1629062_at:165:391; Interrogation_Position=2236; Antisense; GAAACTAATCGAGACACGTCTTAGA
>probe:Drosophila_2:1629062_at:685:275; Interrogation_Position=2252; Antisense; CGTCTTAGATTTTAGTGTTAGCTTC
>probe:Drosophila_2:1629062_at:438:673; Interrogation_Position=2309; Antisense; TAGCCTATGTAATTTGTCAACCAAG
>probe:Drosophila_2:1629062_at:449:493; Interrogation_Position=2324; Antisense; GTCAACCAAGGCGTGCAGCTGTTTA
>probe:Drosophila_2:1629062_at:608:481; Interrogation_Position=2364; Antisense; GTATTTGCAACACAAGACCCGAAAG
>probe:Drosophila_2:1629062_at:257:395; Interrogation_Position=2398; Antisense; GAAATGTAACGCATCGCAATCGCTA
>probe:Drosophila_2:1629062_at:154:295; Interrogation_Position=2412; Antisense; CGCAATCGCTAAAGGAGGTTCTACT
>probe:Drosophila_2:1629062_at:73:435; Interrogation_Position=2426; Antisense; GAGGTTCTACTTTAGCTAACGTCAT
>probe:Drosophila_2:1629062_at:628:137; Interrogation_Position=2444; Antisense; ACGTCATAACGTTGCCACTTAAATG

Paste this into a BLAST search page for me
AGCAACGAACTTAAGCAGCAACTAAGAGTTACTATTTCTAAACACACGCAGTACATACTGTATGCCTTCCTCTTTTTCCTCTTTCCATCGGAAGTCGACTATACCAAATCATACTTAGCAGCGAGGAAACTAATCGAGACACGTCTTAGACGTCTTAGATTTTAGTGTTAGCTTCTAGCCTATGTAATTTGTCAACCAAGGTCAACCAAGGCGTGCAGCTGTTTAGTATTTGCAACACAAGACCCGAAAGGAAATGTAACGCATCGCAATCGCTACGCAATCGCTAAAGGAGGTTCTACTGAGGTTCTACTTTAGCTAACGTCATACGTCATAACGTTGCCACTTAAATG

Full Affymetrix probeset data:

Annotations for 1629062_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime