FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629064_at:

>probe:Drosophila_2:1629064_at:79:315; Interrogation_Position=4223; Antisense; GCCATGTTTTCTGGGCATCGTAGCT
>probe:Drosophila_2:1629064_at:439:347; Interrogation_Position=4237; Antisense; GCATCGTAGCTCTCCTGACTGACTA
>probe:Drosophila_2:1629064_at:556:401; Interrogation_Position=4253; Antisense; GACTGACTACCCGTCTATAACTTAG
>probe:Drosophila_2:1629064_at:12:59; Interrogation_Position=4302; Antisense; ATGTTTTCCAAGTACCTGAAAGGTG
>probe:Drosophila_2:1629064_at:8:209; Interrogation_Position=4343; Antisense; AAGCAATAGGAACCCCATGGTCCCG
>probe:Drosophila_2:1629064_at:376:269; Interrogation_Position=4358; Antisense; CATGGTCCCGTCTACCCAAATATAA
>probe:Drosophila_2:1629064_at:439:663; Interrogation_Position=4380; Antisense; TAAACCATCTAGTCATCGCATGTAT
>probe:Drosophila_2:1629064_at:729:473; Interrogation_Position=4406; Antisense; GTTAAGAGTGCTTTCCACCAGGAAA
>probe:Drosophila_2:1629064_at:376:305; Interrogation_Position=4478; Antisense; CCTAATTCCTACTATTTTTTGTGAG
>probe:Drosophila_2:1629064_at:366:725; Interrogation_Position=4553; Antisense; TTGTAACAAACGTATGCCGAGGTGT
>probe:Drosophila_2:1629064_at:442:197; Interrogation_Position=4586; Antisense; TAAGCGTTACTTGTAGGTGGGACTT
>probe:Drosophila_2:1629064_at:302:537; Interrogation_Position=4620; Antisense; GGTAAACTTGTGCAACATTCGCTAT
>probe:Drosophila_2:1629064_at:227:151; Interrogation_Position=4634; Antisense; ACATTCGCTATGTCTAACCAACTGA
>probe:Drosophila_2:1629064_at:483:381; Interrogation_Position=4723; Antisense; GAACGCAATGCAATGTAACCAGAGA

Paste this into a BLAST search page for me
GCCATGTTTTCTGGGCATCGTAGCTGCATCGTAGCTCTCCTGACTGACTAGACTGACTACCCGTCTATAACTTAGATGTTTTCCAAGTACCTGAAAGGTGAAGCAATAGGAACCCCATGGTCCCGCATGGTCCCGTCTACCCAAATATAATAAACCATCTAGTCATCGCATGTATGTTAAGAGTGCTTTCCACCAGGAAACCTAATTCCTACTATTTTTTGTGAGTTGTAACAAACGTATGCCGAGGTGTTAAGCGTTACTTGTAGGTGGGACTTGGTAAACTTGTGCAACATTCGCTATACATTCGCTATGTCTAACCAACTGAGAACGCAATGCAATGTAACCAGAGA

Full Affymetrix probeset data:

Annotations for 1629064_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720