Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629066_at:

>probe:Drosophila_2:1629066_at:405:327; Interrogation_Position=2658; Antisense; GCGTAGGATTAGAGCTAGTCCGTAC
>probe:Drosophila_2:1629066_at:316:677; Interrogation_Position=2673; Antisense; TAGTCCGTACGAAGTGGTTGCCCTA
>probe:Drosophila_2:1629066_at:673:541; Interrogation_Position=2688; Antisense; GGTTGCCCTACACTGGGAGAAACTC
>probe:Drosophila_2:1629066_at:50:553; Interrogation_Position=2703; Antisense; GGAGAAACTCGTGGTCACTTTGCAT
>probe:Drosophila_2:1629066_at:247:519; Interrogation_Position=2713; Antisense; GTGGTCACTTTGCATGTTCTCTGAA
>probe:Drosophila_2:1629066_at:688:347; Interrogation_Position=2724; Antisense; GCATGTTCTCTGAATGTTCTACTAA
>probe:Drosophila_2:1629066_at:473:57; Interrogation_Position=2737; Antisense; ATGTTCTACTAATACTTGACTTCAA
>probe:Drosophila_2:1629066_at:649:477; Interrogation_Position=2864; Antisense; GTTTCAAATGTTGCCAATTCGCCAG
>probe:Drosophila_2:1629066_at:41:247; Interrogation_Position=2879; Antisense; AATTCGCCAGCGTGTAATCCGATAT
>probe:Drosophila_2:1629066_at:469:509; Interrogation_Position=2933; Antisense; GTGCAATCAGAGTCAGTTACAATTT
>probe:Drosophila_2:1629066_at:715:669; Interrogation_Position=2994; Antisense; TACGACTTCAAATGAGTTTCTCTCA
>probe:Drosophila_2:1629066_at:280:479; Interrogation_Position=3009; Antisense; GTTTCTCTCATTAGCAGGGCAACTT
>probe:Drosophila_2:1629066_at:226:261; Interrogation_Position=3049; Antisense; CAGCGTTTTTCAGTTTTTCATTTTG
>probe:Drosophila_2:1629066_at:461:681; Interrogation_Position=3226; Antisense; TATGAGTTCATGTTCAACGACACAA

Paste this into a BLAST search page for me
GCGTAGGATTAGAGCTAGTCCGTACTAGTCCGTACGAAGTGGTTGCCCTAGGTTGCCCTACACTGGGAGAAACTCGGAGAAACTCGTGGTCACTTTGCATGTGGTCACTTTGCATGTTCTCTGAAGCATGTTCTCTGAATGTTCTACTAAATGTTCTACTAATACTTGACTTCAAGTTTCAAATGTTGCCAATTCGCCAGAATTCGCCAGCGTGTAATCCGATATGTGCAATCAGAGTCAGTTACAATTTTACGACTTCAAATGAGTTTCTCTCAGTTTCTCTCATTAGCAGGGCAACTTCAGCGTTTTTCAGTTTTTCATTTTGTATGAGTTCATGTTCAACGACACAA

Full Affymetrix probeset data:

Annotations for 1629066_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime