Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629067_at:

>probe:Drosophila_2:1629067_at:315:693; Interrogation_Position=1276; Antisense; TTTGACAGCCAGACGTAAGATATGA
>probe:Drosophila_2:1629067_at:411:399; Interrogation_Position=1279; Antisense; GACAGCCAGACGTAAGATATGATAA
>probe:Drosophila_2:1629067_at:319:457; Interrogation_Position=1294; Antisense; GATATGATAAAACCTTGGACCTTGG
>probe:Drosophila_2:1629067_at:150:681; Interrogation_Position=1296; Antisense; TATGATAAAACCTTGGACCTTGGTA
>probe:Drosophila_2:1629067_at:468:413; Interrogation_Position=1311; Antisense; GACCTTGGTAAACTAGTTATCCTTG
>probe:Drosophila_2:1629067_at:530:535; Interrogation_Position=1317; Antisense; GGTAAACTAGTTATCCTTGCCGTAT
>probe:Drosophila_2:1629067_at:160:191; Interrogation_Position=1321; Antisense; AACTAGTTATCCTTGCCGTATTATC
>probe:Drosophila_2:1629067_at:416:21; Interrogation_Position=1323; Antisense; CTAGTTATCCTTGCCGTATTATCCA
>probe:Drosophila_2:1629067_at:215:705; Interrogation_Position=1327; Antisense; TTATCCTTGCCGTATTATCCACATA
>probe:Drosophila_2:1629067_at:108:49; Interrogation_Position=1329; Antisense; ATCCTTGCCGTATTATCCACATAGT
>probe:Drosophila_2:1629067_at:647:305; Interrogation_Position=1331; Antisense; CCTTGCCGTATTATCCACATAGTTA
>probe:Drosophila_2:1629067_at:276:319; Interrogation_Position=1335; Antisense; GCCGTATTATCCACATAGTTACCTA
>probe:Drosophila_2:1629067_at:561:479; Interrogation_Position=1338; Antisense; GTATTATCCACATAGTTACCTACAG
>probe:Drosophila_2:1629067_at:469:47; Interrogation_Position=1343; Antisense; ATCCACATAGTTACCTACAGTTCCT

Paste this into a BLAST search page for me
TTTGACAGCCAGACGTAAGATATGAGACAGCCAGACGTAAGATATGATAAGATATGATAAAACCTTGGACCTTGGTATGATAAAACCTTGGACCTTGGTAGACCTTGGTAAACTAGTTATCCTTGGGTAAACTAGTTATCCTTGCCGTATAACTAGTTATCCTTGCCGTATTATCCTAGTTATCCTTGCCGTATTATCCATTATCCTTGCCGTATTATCCACATAATCCTTGCCGTATTATCCACATAGTCCTTGCCGTATTATCCACATAGTTAGCCGTATTATCCACATAGTTACCTAGTATTATCCACATAGTTACCTACAGATCCACATAGTTACCTACAGTTCCT

Full Affymetrix probeset data:

Annotations for 1629067_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime