FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629069_at:

>probe:Drosophila_2:1629069_at:631:569; Interrogation_Position=3674; Antisense; GGCCAAACCAGTATTTCTACGAGGA
>probe:Drosophila_2:1629069_at:457:653; Interrogation_Position=3707; Antisense; TAAACGCCGAGTGTACTGCTCGTTT
>probe:Drosophila_2:1629069_at:206:339; Interrogation_Position=3741; Antisense; GCTCATTCCATACTGCGTTATTAAT
>probe:Drosophila_2:1629069_at:110:139; Interrogation_Position=3818; Antisense; ACGAGGAGGCTCGTTTTGTGGCCAA
>probe:Drosophila_2:1629069_at:405:653; Interrogation_Position=3896; Antisense; TAATTTCGCCGTACCAAAACCAGTG
>probe:Drosophila_2:1629069_at:10:183; Interrogation_Position=3911; Antisense; AAAACCAGTGTTACGCGCTAAGCCA
>probe:Drosophila_2:1629069_at:40:661; Interrogation_Position=3929; Antisense; TAAGCCAGGTTATTCCCAGTCACAT
>probe:Drosophila_2:1629069_at:550:29; Interrogation_Position=3958; Antisense; ATAACTCCTCAGACTGTGGACTCGT
>probe:Drosophila_2:1629069_at:282:711; Interrogation_Position=4014; Antisense; TTCAAATGCCAGGACACGCGGCTGT
>probe:Drosophila_2:1629069_at:706:331; Interrogation_Position=4031; Antisense; GCGGCTGTGGCTTTCTAACGAACTA
>probe:Drosophila_2:1629069_at:82:133; Interrogation_Position=4083; Antisense; ACCGCGTCGTTGTCTAGTCATATGT
>probe:Drosophila_2:1629069_at:672:611; Interrogation_Position=4134; Antisense; TGAAATGTGGCGCAACCTTCTCGAT
>probe:Drosophila_2:1629069_at:290:203; Interrogation_Position=4147; Antisense; AACCTTCTCGATGATGCTCGCAAGA
>probe:Drosophila_2:1629069_at:565:477; Interrogation_Position=4177; Antisense; GTTTACTTCAATTTGGACCGCGATG

Paste this into a BLAST search page for me
GGCCAAACCAGTATTTCTACGAGGATAAACGCCGAGTGTACTGCTCGTTTGCTCATTCCATACTGCGTTATTAATACGAGGAGGCTCGTTTTGTGGCCAATAATTTCGCCGTACCAAAACCAGTGAAAACCAGTGTTACGCGCTAAGCCATAAGCCAGGTTATTCCCAGTCACATATAACTCCTCAGACTGTGGACTCGTTTCAAATGCCAGGACACGCGGCTGTGCGGCTGTGGCTTTCTAACGAACTAACCGCGTCGTTGTCTAGTCATATGTTGAAATGTGGCGCAACCTTCTCGATAACCTTCTCGATGATGCTCGCAAGAGTTTACTTCAATTTGGACCGCGATG

Full Affymetrix probeset data:

Annotations for 1629069_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720