FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629070_at:

>probe:Drosophila_2:1629070_at:89:723; Interrogation_Position=1630; Antisense; TTGCCATCGCCTTGCAGGAGACGAA
>probe:Drosophila_2:1629070_at:607:213; Interrogation_Position=1659; Antisense; AAGAGTGCCAGTCAAATCCAGAGCT
>probe:Drosophila_2:1629070_at:356:47; Interrogation_Position=1674; Antisense; ATCCAGAGCTGGTTGAGCGGACGTT
>probe:Drosophila_2:1629070_at:622:371; Interrogation_Position=1709; Antisense; GAAGGACTCCATGCCATAGTTTATT
>probe:Drosophila_2:1629070_at:213:335; Interrogation_Position=1737; Antisense; GCTGAATGCCATTGAACTCGTAGTT
>probe:Drosophila_2:1629070_at:244:279; Interrogation_Position=1753; Antisense; CTCGTAGTTGAATAAGCAGCCCTTG
>probe:Drosophila_2:1629070_at:387:13; Interrogation_Position=1836; Antisense; ATTACCTCTGGCACAATTGAACTTC
>probe:Drosophila_2:1629070_at:619:697; Interrogation_Position=1899; Antisense; TTTTTCGGACTCAAGGCCAACCTAG
>probe:Drosophila_2:1629070_at:56:579; Interrogation_Position=1913; Antisense; GGCCAACCTAGCTTATTGGTGTTCC
>probe:Drosophila_2:1629070_at:718:727; Interrogation_Position=1928; Antisense; TTGGTGTTCCACGATGTTCAGATAC
>probe:Drosophila_2:1629070_at:88:659; Interrogation_Position=1975; Antisense; TAAGTACTCAAGGTCACGCCCAAAT
>probe:Drosophila_2:1629070_at:363:95; Interrogation_Position=2009; Antisense; AGATTCAATGGACTTCCACTTCCAC
>probe:Drosophila_2:1629070_at:408:475; Interrogation_Position=2037; Antisense; GTTACATATGTACGTGCTCTCCTTT
>probe:Drosophila_2:1629070_at:693:335; Interrogation_Position=2052; Antisense; GCTCTCCTTTTGTATAAACCACCTG

Paste this into a BLAST search page for me
TTGCCATCGCCTTGCAGGAGACGAAAAGAGTGCCAGTCAAATCCAGAGCTATCCAGAGCTGGTTGAGCGGACGTTGAAGGACTCCATGCCATAGTTTATTGCTGAATGCCATTGAACTCGTAGTTCTCGTAGTTGAATAAGCAGCCCTTGATTACCTCTGGCACAATTGAACTTCTTTTTCGGACTCAAGGCCAACCTAGGGCCAACCTAGCTTATTGGTGTTCCTTGGTGTTCCACGATGTTCAGATACTAAGTACTCAAGGTCACGCCCAAATAGATTCAATGGACTTCCACTTCCACGTTACATATGTACGTGCTCTCCTTTGCTCTCCTTTTGTATAAACCACCTG

Full Affymetrix probeset data:

Annotations for 1629070_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720