Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629072_at:

>probe:Drosophila_2:1629072_at:376:93; Interrogation_Position=3447; Antisense; AGTTCGATGCTCTATTGGTGTTTAT
>probe:Drosophila_2:1629072_at:483:483; Interrogation_Position=3520; Antisense; GTAGCTTTACGATCTGGAAATTCCG
>probe:Drosophila_2:1629072_at:178:15; Interrogation_Position=3546; Antisense; ATTACGCCAGTGTTCAGATTCTTCC
>probe:Drosophila_2:1629072_at:26:569; Interrogation_Position=3605; Antisense; GGCAGTGAGCTCATCGATTCAGTTT
>probe:Drosophila_2:1629072_at:329:479; Interrogation_Position=3626; Antisense; GTTTAATTTGGATGCTCCGCACGAC
>probe:Drosophila_2:1629072_at:203:637; Interrogation_Position=3651; Antisense; TCGACGATGCTTCACTCAAACTATC
>probe:Drosophila_2:1629072_at:57:179; Interrogation_Position=3668; Antisense; AAACTATCTTTTTCTGATCGGCGGT
>probe:Drosophila_2:1629072_at:557:381; Interrogation_Position=3752; Antisense; GAACGAGACTTTCCTGGCCTGTGGT
>probe:Drosophila_2:1629072_at:281:465; Interrogation_Position=3780; Antisense; GATTGTCAAACGGAGTGCGCCACGC
>probe:Drosophila_2:1629072_at:119:393; Interrogation_Position=3808; Antisense; GAAAGCCCTGTCTGGTCAGGCACAT
>probe:Drosophila_2:1629072_at:311:13; Interrogation_Position=3848; Antisense; ATGCTACTGCAACAAGGGCTTCGCG
>probe:Drosophila_2:1629072_at:41:575; Interrogation_Position=3918; Antisense; GGCGGCTACGGAAACTGAATTAACT
>probe:Drosophila_2:1629072_at:189:143; Interrogation_Position=4002; Antisense; ACTGGCATTGTGTATGGCGCCTACA
>probe:Drosophila_2:1629072_at:72:479; Interrogation_Position=4013; Antisense; GTATGGCGCCTACAATGCAATGATA

Paste this into a BLAST search page for me
AGTTCGATGCTCTATTGGTGTTTATGTAGCTTTACGATCTGGAAATTCCGATTACGCCAGTGTTCAGATTCTTCCGGCAGTGAGCTCATCGATTCAGTTTGTTTAATTTGGATGCTCCGCACGACTCGACGATGCTTCACTCAAACTATCAAACTATCTTTTTCTGATCGGCGGTGAACGAGACTTTCCTGGCCTGTGGTGATTGTCAAACGGAGTGCGCCACGCGAAAGCCCTGTCTGGTCAGGCACATATGCTACTGCAACAAGGGCTTCGCGGGCGGCTACGGAAACTGAATTAACTACTGGCATTGTGTATGGCGCCTACAGTATGGCGCCTACAATGCAATGATA

Full Affymetrix probeset data:

Annotations for 1629072_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime