FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629076_at:

>probe:Drosophila_2:1629076_at:37:343; Interrogation_Position=372; Antisense; GCTTTAATCTCCTCGATCGGAACAT
>probe:Drosophila_2:1629076_at:121:191; Interrogation_Position=392; Antisense; AACATTGTTTATCGGCAGCAACGCC
>probe:Drosophila_2:1629076_at:57:135; Interrogation_Position=412; Antisense; ACGCCAGCTTGTGGATAGCGCGCTT
>probe:Drosophila_2:1629076_at:481:135; Interrogation_Position=443; Antisense; ACGCACTCTGCGGAAAATCACAGTT
>probe:Drosophila_2:1629076_at:660:699; Interrogation_Position=486; Antisense; TTTTAATTGGTTATGCTCGCTACGA
>probe:Drosophila_2:1629076_at:152:633; Interrogation_Position=502; Antisense; TCGCTACGAGTTGGAACGGAGGACC
>probe:Drosophila_2:1629076_at:506:73; Interrogation_Position=521; Antisense; AGGACCAGTAGGTACTTTGCCCTCA
>probe:Drosophila_2:1629076_at:297:307; Interrogation_Position=541; Antisense; CCTCATGCGCTTATCATCCTTTGAT
>probe:Drosophila_2:1629076_at:350:47; Interrogation_Position=556; Antisense; ATCCTTTGATAATTGGGTGCCGGCC
>probe:Drosophila_2:1629076_at:263:535; Interrogation_Position=571; Antisense; GGTGCCGGCCATTGAAATCCGACGA
>probe:Drosophila_2:1629076_at:265:375; Interrogation_Position=594; Antisense; GAAGAGTTCTTCAACCGACCATCTA
>probe:Drosophila_2:1629076_at:640:709; Interrogation_Position=603; Antisense; TTCAACCGACCATCTACTCGAAGAT
>probe:Drosophila_2:1629076_at:711:273; Interrogation_Position=649; Antisense; CATTGTGACCCTTACAGCGAGGCAA
>probe:Drosophila_2:1629076_at:294:355; Interrogation_Position=670; Antisense; GCAAGTGGACTTGACGGCGGTACAA

Paste this into a BLAST search page for me
GCTTTAATCTCCTCGATCGGAACATAACATTGTTTATCGGCAGCAACGCCACGCCAGCTTGTGGATAGCGCGCTTACGCACTCTGCGGAAAATCACAGTTTTTTAATTGGTTATGCTCGCTACGATCGCTACGAGTTGGAACGGAGGACCAGGACCAGTAGGTACTTTGCCCTCACCTCATGCGCTTATCATCCTTTGATATCCTTTGATAATTGGGTGCCGGCCGGTGCCGGCCATTGAAATCCGACGAGAAGAGTTCTTCAACCGACCATCTATTCAACCGACCATCTACTCGAAGATCATTGTGACCCTTACAGCGAGGCAAGCAAGTGGACTTGACGGCGGTACAA

Full Affymetrix probeset data:

Annotations for 1629076_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720