Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629078_s_at:

>probe:Drosophila_2:1629078_s_at:562:95; Interrogation_Position=3780; Antisense; AGATTGGCGGTCGTTGTCTCTCCAA
>probe:Drosophila_2:1629078_s_at:448:499; Interrogation_Position=3795; Antisense; GTCTCTCCAACTGACTCCAATTGAA
>probe:Drosophila_2:1629078_s_at:330:195; Interrogation_Position=3803; Antisense; AACTGACTCCAATTGAATGTGTGTA
>probe:Drosophila_2:1629078_s_at:725:397; Interrogation_Position=3866; Antisense; GACAGACTGCAAAGTTTCTTGAAAC
>probe:Drosophila_2:1629078_s_at:157:61; Interrogation_Position=3911; Antisense; ATGTCTAAGTTGCTACCACTGCTAC
>probe:Drosophila_2:1629078_s_at:676:465; Interrogation_Position=3919; Antisense; GTTGCTACCACTGCTACTACTAGAA
>probe:Drosophila_2:1629078_s_at:280:143; Interrogation_Position=3928; Antisense; ACTGCTACTACTAGAACGCGCCCAT
>probe:Drosophila_2:1629078_s_at:1:273; Interrogation_Position=3956; Antisense; CTCCCATATTTACCTTTAAGCTACA
>probe:Drosophila_2:1629078_s_at:728:723; Interrogation_Position=4047; Antisense; TTGTACATACATATCGCCGTTGGTC
>probe:Drosophila_2:1629078_s_at:516:299; Interrogation_Position=4061; Antisense; CGCCGTTGGTCGATATACATCTAAA
>probe:Drosophila_2:1629078_s_at:355:661; Interrogation_Position=4148; Antisense; TAACGCAATATGCAACAACACACAT
>probe:Drosophila_2:1629078_s_at:16:295; Interrogation_Position=4218; Antisense; CGATGTCATAGAACGGAGAGCCACT
>probe:Drosophila_2:1629078_s_at:158:313; Interrogation_Position=4237; Antisense; GCCACTGATAGTGAGAGAAATCTGT
>probe:Drosophila_2:1629078_s_at:678:11; Interrogation_Position=4297; Antisense; ATATGAGTACCAGAACAAGAATGTC

Paste this into a BLAST search page for me
AGATTGGCGGTCGTTGTCTCTCCAAGTCTCTCCAACTGACTCCAATTGAAAACTGACTCCAATTGAATGTGTGTAGACAGACTGCAAAGTTTCTTGAAACATGTCTAAGTTGCTACCACTGCTACGTTGCTACCACTGCTACTACTAGAAACTGCTACTACTAGAACGCGCCCATCTCCCATATTTACCTTTAAGCTACATTGTACATACATATCGCCGTTGGTCCGCCGTTGGTCGATATACATCTAAATAACGCAATATGCAACAACACACATCGATGTCATAGAACGGAGAGCCACTGCCACTGATAGTGAGAGAAATCTGTATATGAGTACCAGAACAAGAATGTC

Full Affymetrix probeset data:

Annotations for 1629078_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime