FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629081_at:

>probe:Drosophila_2:1629081_at:341:273; Interrogation_Position=2092; Antisense; CATTCTTCAGCTCCATTTCAATTAG
>probe:Drosophila_2:1629081_at:187:633; Interrogation_Position=2109; Antisense; TCAATTAGGGTTTTGCCGGCTGTCA
>probe:Drosophila_2:1629081_at:219:573; Interrogation_Position=2126; Antisense; GGCTGTCAGTTGTTCGAGTGCCACT
>probe:Drosophila_2:1629081_at:668:293; Interrogation_Position=2201; Antisense; CGACCCACAGACAGCAACTACAATG
>probe:Drosophila_2:1629081_at:228:109; Interrogation_Position=2237; Antisense; AGAAGCACGCGTCATTTGCCGGCGA
>probe:Drosophila_2:1629081_at:464:719; Interrogation_Position=2252; Antisense; TTGCCGGCGAAATGCATTTGCGCTA
>probe:Drosophila_2:1629081_at:5:345; Interrogation_Position=2265; Antisense; GCATTTGCGCTAACCAAGACCATTT
>probe:Drosophila_2:1629081_at:290:291; Interrogation_Position=2305; Antisense; CGGTGACCCAGTTGCAAAGCCAAGA
>probe:Drosophila_2:1629081_at:551:213; Interrogation_Position=2326; Antisense; AAGAGCCCGGAGATACATCCTGATG
>probe:Drosophila_2:1629081_at:269:49; Interrogation_Position=2353; Antisense; ATGCTGACTGACTGGCGGACGGACT
>probe:Drosophila_2:1629081_at:447:141; Interrogation_Position=2371; Antisense; ACGGACTTGAGTGATTGGCGGTTAC
>probe:Drosophila_2:1629081_at:32:439; Interrogation_Position=2495; Antisense; GAGGCGAAGATTTTCCTATCCTATG
>probe:Drosophila_2:1629081_at:700:17; Interrogation_Position=2575; Antisense; ATTTCATCCTCATTTATTCTTTCTA
>probe:Drosophila_2:1629081_at:84:31; Interrogation_Position=2644; Antisense; ATAAATGAATGTTCTTTCCTTCCAA

Paste this into a BLAST search page for me
CATTCTTCAGCTCCATTTCAATTAGTCAATTAGGGTTTTGCCGGCTGTCAGGCTGTCAGTTGTTCGAGTGCCACTCGACCCACAGACAGCAACTACAATGAGAAGCACGCGTCATTTGCCGGCGATTGCCGGCGAAATGCATTTGCGCTAGCATTTGCGCTAACCAAGACCATTTCGGTGACCCAGTTGCAAAGCCAAGAAAGAGCCCGGAGATACATCCTGATGATGCTGACTGACTGGCGGACGGACTACGGACTTGAGTGATTGGCGGTTACGAGGCGAAGATTTTCCTATCCTATGATTTCATCCTCATTTATTCTTTCTAATAAATGAATGTTCTTTCCTTCCAA

Full Affymetrix probeset data:

Annotations for 1629081_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720