FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629082_at:

>probe:Drosophila_2:1629082_at:179:611; Interrogation_Position=109; Antisense; TGAACCGAATTTGCCAGAGTCTCCG
>probe:Drosophila_2:1629082_at:182:311; Interrogation_Position=256; Antisense; CCAACAAGGTGGTCGTCTTCATGAA
>probe:Drosophila_2:1629082_at:597:445; Interrogation_Position=338; Antisense; GATGCACGGTGTCCAGTACGATGCC
>probe:Drosophila_2:1629082_at:173:489; Interrogation_Position=353; Antisense; GTACGATGCCCACGATGTGCTGCAA
>probe:Drosophila_2:1629082_at:107:597; Interrogation_Position=368; Antisense; TGTGCTGCAAAACGAGTCCCTGCGA
>probe:Drosophila_2:1629082_at:294:493; Interrogation_Position=399; Antisense; GTCAAGGACTACACCGACTGGCCGA
>probe:Drosophila_2:1629082_at:544:413; Interrogation_Position=422; Antisense; GACCATTCCGCAGGTGTTCATCAAT
>probe:Drosophila_2:1629082_at:558:33; Interrogation_Position=441; Antisense; ATCAATGGCGAATTTGTCGGCGGTT
>probe:Drosophila_2:1629082_at:349:539; Interrogation_Position=462; Antisense; GGTTGCGACATCCTGCTGCAGATGC
>probe:Drosophila_2:1629082_at:141:291; Interrogation_Position=523; Antisense; CGGGCATCATTTCGGAGCTGCTGAA
>probe:Drosophila_2:1629082_at:169:409; Interrogation_Position=599; Antisense; GAGCGCCCAAAGATCAAATTCCCTT
>probe:Drosophila_2:1629082_at:625:451; Interrogation_Position=610; Antisense; GATCAAATTCCCTTCCTAAATCTGT
>probe:Drosophila_2:1629082_at:59:165; Interrogation_Position=627; Antisense; AAATCTGTTAGTCACGCAACGTTTT
>probe:Drosophila_2:1629082_at:519:217; Interrogation_Position=91; Antisense; AAGTCGCTGCCGTCAAGATGAACCG

Paste this into a BLAST search page for me
TGAACCGAATTTGCCAGAGTCTCCGCCAACAAGGTGGTCGTCTTCATGAAGATGCACGGTGTCCAGTACGATGCCGTACGATGCCCACGATGTGCTGCAATGTGCTGCAAAACGAGTCCCTGCGAGTCAAGGACTACACCGACTGGCCGAGACCATTCCGCAGGTGTTCATCAATATCAATGGCGAATTTGTCGGCGGTTGGTTGCGACATCCTGCTGCAGATGCCGGGCATCATTTCGGAGCTGCTGAAGAGCGCCCAAAGATCAAATTCCCTTGATCAAATTCCCTTCCTAAATCTGTAAATCTGTTAGTCACGCAACGTTTTAAGTCGCTGCCGTCAAGATGAACCG

Full Affymetrix probeset data:

Annotations for 1629082_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720