FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629083_at:

>probe:Drosophila_2:1629083_at:499:617; Interrogation_Position=114; Antisense; TGCGACTTTGAAAAACCCAATCTGT
>probe:Drosophila_2:1629083_at:431:201; Interrogation_Position=127; Antisense; AACCCAATCTGTGGCGAGGAGTTTG
>probe:Drosophila_2:1629083_at:587:187; Interrogation_Position=13; Antisense; AACAGTTCGGTTTGAGATTTCAGTA
>probe:Drosophila_2:1629083_at:232:477; Interrogation_Position=147; Antisense; GTTTGGCGTCAAGGGTACTTGCCGT
>probe:Drosophila_2:1629083_at:635:719; Interrogation_Position=171; Antisense; TTCCCTGCAACCCATGTGGACCTAT
>probe:Drosophila_2:1629083_at:463:555; Interrogation_Position=188; Antisense; GGACCTATCGCCCAGATACGAACGA
>probe:Drosophila_2:1629083_at:591:455; Interrogation_Position=202; Antisense; GATACGAACGAGTGCTTCACCTTCA
>probe:Drosophila_2:1629083_at:628:85; Interrogation_Position=212; Antisense; AGTGCTTCACCTTCAATTACTCCGG
>probe:Drosophila_2:1629083_at:605:571; Interrogation_Position=235; Antisense; GGCTGCCACGGAAACAATAATCTAT
>probe:Drosophila_2:1629083_at:265:427; Interrogation_Position=26; Antisense; GAGATTTCAGTAAAGCAAGCCCAAG
>probe:Drosophila_2:1629083_at:625:89; Interrogation_Position=330; Antisense; AGTTCGGTTTTGTTATCCTAATGTG
>probe:Drosophila_2:1629083_at:650:27; Interrogation_Position=66; Antisense; ATACCTAGTCGTTTTTGCACTCATC
>probe:Drosophila_2:1629083_at:234:147; Interrogation_Position=84; Antisense; ACTCATCTGCTGTCTTGTGGCATCA
>probe:Drosophila_2:1629083_at:637:595; Interrogation_Position=99; Antisense; TGTGGCATCAGCATTTGCGACTTTG

Paste this into a BLAST search page for me
TGCGACTTTGAAAAACCCAATCTGTAACCCAATCTGTGGCGAGGAGTTTGAACAGTTCGGTTTGAGATTTCAGTAGTTTGGCGTCAAGGGTACTTGCCGTTTCCCTGCAACCCATGTGGACCTATGGACCTATCGCCCAGATACGAACGAGATACGAACGAGTGCTTCACCTTCAAGTGCTTCACCTTCAATTACTCCGGGGCTGCCACGGAAACAATAATCTATGAGATTTCAGTAAAGCAAGCCCAAGAGTTCGGTTTTGTTATCCTAATGTGATACCTAGTCGTTTTTGCACTCATCACTCATCTGCTGTCTTGTGGCATCATGTGGCATCAGCATTTGCGACTTTG

Full Affymetrix probeset data:

Annotations for 1629083_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720