FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629084_at:

>probe:Drosophila_2:1629084_at:428:521; Interrogation_Position=1021; Antisense; GTGGCTTCTCGGACAGAACTGGCAA
>probe:Drosophila_2:1629084_at:164:567; Interrogation_Position=1041; Antisense; GGCAACATGCCGGACATATTCCACA
>probe:Drosophila_2:1629084_at:540:21; Interrogation_Position=1056; Antisense; ATATTCCACACGCTGTTCGGCATCG
>probe:Drosophila_2:1629084_at:267:669; Interrogation_Position=1093; Antisense; TACTGGGACATTCCGGCCTGAAGGC
>probe:Drosophila_2:1629084_at:621:33; Interrogation_Position=1167; Antisense; ATCAAGCCGCAACTATTGCCGAGGC
>probe:Drosophila_2:1629084_at:197:463; Interrogation_Position=1200; Antisense; GATTCATCGATTCCACATGCAGCCA
>probe:Drosophila_2:1629084_at:608:353; Interrogation_Position=1218; Antisense; GCAGCCAGTGCGTAGCCAATGTGTA
>probe:Drosophila_2:1629084_at:273:485; Interrogation_Position=1240; Antisense; GTAGTGCAGCAGACCTCTGACGTAT
>probe:Drosophila_2:1629084_at:441:309; Interrogation_Position=1267; Antisense; CCACGCTAGCGTTTCTTAGTTTTAT
>probe:Drosophila_2:1629084_at:562:21; Interrogation_Position=1313; Antisense; ATAGCAGGAACACCCTTTCTTTACT
>probe:Drosophila_2:1629084_at:409:475; Interrogation_Position=1348; Antisense; GTTATGCATTTACCCCTCTATTATT
>probe:Drosophila_2:1629084_at:457:283; Interrogation_Position=900; Antisense; CTGCCGGATGTATGCTATTCGTGGT
>probe:Drosophila_2:1629084_at:129:317; Interrogation_Position=955; Antisense; GCCTGCACTGGATCAGCTCGGAGAA
>probe:Drosophila_2:1629084_at:277:351; Interrogation_Position=986; Antisense; GCAGTTCATACTGTCGTGCCAGGAC

Paste this into a BLAST search page for me
GTGGCTTCTCGGACAGAACTGGCAAGGCAACATGCCGGACATATTCCACAATATTCCACACGCTGTTCGGCATCGTACTGGGACATTCCGGCCTGAAGGCATCAAGCCGCAACTATTGCCGAGGCGATTCATCGATTCCACATGCAGCCAGCAGCCAGTGCGTAGCCAATGTGTAGTAGTGCAGCAGACCTCTGACGTATCCACGCTAGCGTTTCTTAGTTTTATATAGCAGGAACACCCTTTCTTTACTGTTATGCATTTACCCCTCTATTATTCTGCCGGATGTATGCTATTCGTGGTGCCTGCACTGGATCAGCTCGGAGAAGCAGTTCATACTGTCGTGCCAGGAC

Full Affymetrix probeset data:

Annotations for 1629084_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720