Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629085_at:

>probe:Drosophila_2:1629085_at:716:715; Interrogation_Position=130; Antisense; TTCGACGCCTGGAATCCTGGACAAA
>probe:Drosophila_2:1629085_at:533:255; Interrogation_Position=151; Antisense; CAAAATTGCAGCTCGGGTGCTCGCT
>probe:Drosophila_2:1629085_at:569:135; Interrogation_Position=182; Antisense; ACGCATACTGCGTTCGGATCGACAA
>probe:Drosophila_2:1629085_at:45:211; Interrogation_Position=205; Antisense; AAGAAGATCGTGCACGCCGGATTCG
>probe:Drosophila_2:1629085_at:515:347; Interrogation_Position=276; Antisense; GCATGCGGTGCAGTATTCAGACTTC
>probe:Drosophila_2:1629085_at:351:525; Interrogation_Position=369; Antisense; GGGCACCACTGCAGAAGACTTTCGC
>probe:Drosophila_2:1629085_at:513:211; Interrogation_Position=383; Antisense; AAGACTTTCGCAGCATACCACGGGT
>probe:Drosophila_2:1629085_at:493:451; Interrogation_Position=427; Antisense; GATCGTATCGATCGCGAACTCTGCA
>probe:Drosophila_2:1629085_at:444:193; Interrogation_Position=443; Antisense; AACTCTGCACCTTGAAGTTCCAGCA
>probe:Drosophila_2:1629085_at:669:521; Interrogation_Position=533; Antisense; GTGGCCCCTTTAGCGCAAAAATTCT
>probe:Drosophila_2:1629085_at:535:729; Interrogation_Position=587; Antisense; TTGGCATCATCATCTTCGGCTTGAG
>probe:Drosophila_2:1629085_at:246:725; Interrogation_Position=607; Antisense; TTGAGCTCCTGTGCGGGCCTAAGTG
>probe:Drosophila_2:1629085_at:642:515; Interrogation_Position=629; Antisense; GTGTCTGCACCAATGTGACTTTCTA
>probe:Drosophila_2:1629085_at:375:545; Interrogation_Position=662; Antisense; GGATCTGGGATGCTCTGGTTAACTT

Paste this into a BLAST search page for me
TTCGACGCCTGGAATCCTGGACAAACAAAATTGCAGCTCGGGTGCTCGCTACGCATACTGCGTTCGGATCGACAAAAGAAGATCGTGCACGCCGGATTCGGCATGCGGTGCAGTATTCAGACTTCGGGCACCACTGCAGAAGACTTTCGCAAGACTTTCGCAGCATACCACGGGTGATCGTATCGATCGCGAACTCTGCAAACTCTGCACCTTGAAGTTCCAGCAGTGGCCCCTTTAGCGCAAAAATTCTTTGGCATCATCATCTTCGGCTTGAGTTGAGCTCCTGTGCGGGCCTAAGTGGTGTCTGCACCAATGTGACTTTCTAGGATCTGGGATGCTCTGGTTAACTT

Full Affymetrix probeset data:

Annotations for 1629085_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime