FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629088_at:

>probe:Drosophila_2:1629088_at:413:511; Interrogation_Position=140; Antisense; GTGAACTCGGAGTTCCTGACACTCA
>probe:Drosophila_2:1629088_at:234:323; Interrogation_Position=195; Antisense; GCGACTTCGAGAACGCCGAGGACGT
>probe:Drosophila_2:1629088_at:376:367; Interrogation_Position=237; Antisense; GAATCGGCTACAACATGGGCATGCG
>probe:Drosophila_2:1629088_at:99:407; Interrogation_Position=261; Antisense; GACTGATCGAGGACTTTCTGGCCAG
>probe:Drosophila_2:1629088_at:463:69; Interrogation_Position=339; Antisense; AGGCGTTCCGCATCTACCTGAATAT
>probe:Drosophila_2:1629088_at:317:469; Interrogation_Position=403; Antisense; GTTCTCCCTGGTATTCGATAGCAAT
>probe:Drosophila_2:1629088_at:173:363; Interrogation_Position=423; Antisense; GCAATCCGCTGACGGAGTTCGTCGA
>probe:Drosophila_2:1629088_at:485:237; Interrogation_Position=467; Antisense; AATCTGCGCTACAGTGCCATACTCA
>probe:Drosophila_2:1629088_at:252:267; Interrogation_Position=536; Antisense; CAGTGCTGGTTCGTGCAGGCAAGAT
>probe:Drosophila_2:1629088_at:370:395; Interrogation_Position=573; Antisense; GACAATGTGACGGAACTGCGCGTTA
>probe:Drosophila_2:1629088_at:569:193; Interrogation_Position=586; Antisense; AACTGCGCGTTAAGTTCGTGCGGCG
>probe:Drosophila_2:1629088_at:320:621; Interrogation_Position=604; Antisense; TGCGGCGTCTAGAGGAGGTCATACC
>probe:Drosophila_2:1629088_at:500:433; Interrogation_Position=618; Antisense; GAGGTCATACCAGCTGGCGAGGATT
>probe:Drosophila_2:1629088_at:91:519; Interrogation_Position=654; Antisense; GTGGATCAGTGCATCGGAGCGCAAA

Paste this into a BLAST search page for me
GTGAACTCGGAGTTCCTGACACTCAGCGACTTCGAGAACGCCGAGGACGTGAATCGGCTACAACATGGGCATGCGGACTGATCGAGGACTTTCTGGCCAGAGGCGTTCCGCATCTACCTGAATATGTTCTCCCTGGTATTCGATAGCAATGCAATCCGCTGACGGAGTTCGTCGAAATCTGCGCTACAGTGCCATACTCACAGTGCTGGTTCGTGCAGGCAAGATGACAATGTGACGGAACTGCGCGTTAAACTGCGCGTTAAGTTCGTGCGGCGTGCGGCGTCTAGAGGAGGTCATACCGAGGTCATACCAGCTGGCGAGGATTGTGGATCAGTGCATCGGAGCGCAAA

Full Affymetrix probeset data:

Annotations for 1629088_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720