Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629089_a_at:

>probe:Drosophila_2:1629089_a_at:328:549; Interrogation_Position=208; Antisense; GGAGGATCCTTCATCGAACCGCTAT
>probe:Drosophila_2:1629089_a_at:295:131; Interrogation_Position=225; Antisense; ACCGCTATGGCGACATTTTCTTCAT
>probe:Drosophila_2:1629089_a_at:399:149; Interrogation_Position=237; Antisense; ACATTTTCTTCATCGAACCCGGCAG
>probe:Drosophila_2:1629089_a_at:261:133; Interrogation_Position=273; Antisense; ACCGCATTCGCGATCAACTGGAAAA
>probe:Drosophila_2:1629089_a_at:498:169; Interrogation_Position=304; Antisense; AAAGGATTTACCCAGCTACGACGAG
>probe:Drosophila_2:1629089_a_at:680:117; Interrogation_Position=317; Antisense; AGCTACGACGAGGTGATGCGCATGT
>probe:Drosophila_2:1629089_a_at:511:531; Interrogation_Position=401; Antisense; GGTGTACCCAGTCCCATTGGAATCG
>probe:Drosophila_2:1629089_a_at:254:577; Interrogation_Position=436; Antisense; GGCGCCACCGTATTCGGAGACAGAT
>probe:Drosophila_2:1629089_a_at:643:639; Interrogation_Position=449; Antisense; TCGGAGACAGATCCACATTCCTCGT
>probe:Drosophila_2:1629089_a_at:7:353; Interrogation_Position=479; Antisense; GCAGAAGCCACTGTCATCGCAATGG
>probe:Drosophila_2:1629089_a_at:707:627; Interrogation_Position=571; Antisense; TCCATTGCCAACGACAGCGGTGTGA
>probe:Drosophila_2:1629089_a_at:521:585; Interrogation_Position=618; Antisense; TGGAACTGAAGCATTCGCCGTGCCA
>probe:Drosophila_2:1629089_a_at:131:595; Interrogation_Position=646; Antisense; TGGGCCACACAGATGCCACTTTGTG
>probe:Drosophila_2:1629089_a_at:222:149; Interrogation_Position=663; Antisense; ACTTTGTGTGCGCTTTCAGTACAGA

Paste this into a BLAST search page for me
GGAGGATCCTTCATCGAACCGCTATACCGCTATGGCGACATTTTCTTCATACATTTTCTTCATCGAACCCGGCAGACCGCATTCGCGATCAACTGGAAAAAAAGGATTTACCCAGCTACGACGAGAGCTACGACGAGGTGATGCGCATGTGGTGTACCCAGTCCCATTGGAATCGGGCGCCACCGTATTCGGAGACAGATTCGGAGACAGATCCACATTCCTCGTGCAGAAGCCACTGTCATCGCAATGGTCCATTGCCAACGACAGCGGTGTGATGGAACTGAAGCATTCGCCGTGCCATGGGCCACACAGATGCCACTTTGTGACTTTGTGTGCGCTTTCAGTACAGA

Full Affymetrix probeset data:

Annotations for 1629089_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime